Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10947  (registered. 2012)
Contig Information
Length 647 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115439177|ref|NP_001043868.1|| Os01g0679700 [Oryza sativa (japonica cultivar-group)]
Score 189
Evalue 1.00E-46
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10947
TTTTTTTTTTAGAAGCACAAATGCACAGGCGGCCCCGCTTTTTTTTCTAAGAACAGATGACAATAGCTTTAAGATTCAAGAACCAACGACACACACAACG
AATACCCTTAGACAATCAACTAAGCACGATAAACGAGATACACATTGTAACGTAGCTGGATACATTCAGAACCCCAACAAGCCGATAAATAACATTGTAT
GTTGTCAATTTAGGCTATATTGCGTCGAATGAGTCTCGTCTGAACTACAAAATCCAGAGGCTCCTTTGTCAGATTGACCGCGATCAAGCTTCAGTCTGCT
CCCTCAGGCGACGGATCGTGCTCCTGACAGTGACCGCACTGGCGGTGTTCATGGTATAGGCACCACCGGCCTTAACCTTCCCGCAGTCCTTGCATCCCCA
GATTCCGACTGCTTTCCTCTTCACGGCAAACTTGCCACAGAACTCACAGAAGTACTTGGAGTGCTGGGAGACCTCCATCTTCTTGATCTGCTTACGCAGA
CTGGCACCGTACCTTGTACCATATTTGCCAACGATTCCAGCCTTCTTGGTGCGCTTCGTCATCTCGTCGGCGAGGAGGAGGCGTCCGCAACAACGGGCGG
CGGCGGCGGCGGCAAAGAGGGCAGGGAGGCGGCGGCGCGCCTCGTGC
page-top