Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10944  (registered. 2012)
Contig Information
Length 813 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2493132|sp|Q40079.1|VATB2_HORVU|VATB2_HORVU RecName: Full=V-type proton ATPase subunit B 2; Short=V-ATPase
Score 319
Evalue 2.00E-85
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10944
TTTTTTTTTTAACAAAGAACAAATCAATATTGTTTACATTTTCCAGAAGTCCAAAAATGTATAACCAACATCTTCGGGCATGTACGCGCCTACGGCTTTT
CAGTTTTGCTGCACAATACAGGGAAATGAAACCAGAAAGAGGTCTAGCTTGTGAACGGAGGCTACATGGAATTACAAAGCTGCCAGTGCACAAGACATGT
GGGGTACAACTTGTGCATACAGACTGGAAAGAATAGGATCTGACTATATAACGTAGCAAAATGATACAAGTTTGGATTCTTCTCTTATTCAAGCTGTTCA
TCATGAAAAAAATGAATTTTTATGAACAAAATGGATCAATGGGTGGCATCTCTGCTGTAGAACTGATCCAAGGTCTTCGCAGGAATACGGTGGAGAAGTT
CACGGGGGAATATGCGTAGCAATGTCCATGCCAGATCAAGTGACTGAAAAATGTTCCGAGTATCATATGCTCCTTGCGCTACAAATTTCCTCTCAAACTT
GTCGAGGAATTCTAAATAGAGCAGGTCCTCAGATGAAAGAGCCTCCTCTCCGACAACTGCTTTCATGGCTTGAACATCCTTCCCAATGGCGTAGTTGGCA
TACAGCTGATTGGACACATCTGAATGATCCCGGCGTGTCATACCTTCACCAATAGCACTCTTCATCAGACGAGAAAGAGATGGCAGGACGTTGATGGGTG
GGTATATCTGTCTATTATGAAGCTGTCTGTCAATATATATCTGCCCTTCGGTAATGTATCCCGTAAGATCAGGAGTTGGATGAGTGATATCATCATTAGG
CATTGTAAGAATA
page-top