Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10941  (registered. 2012)
Contig Information
Length 737 bp
Clones alternative view 95 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 8
Wh_yd Spikelet at late flowering 6
Wh_SH - 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 4
WH_XA Root 2
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig10941
TTTTTTTTTTCAGTCATTCATGTGCTTATATACAAGCACAGATAGATATGAAATAAGCTTATTTGCTAGGTTGCTGGTCTGTTACAGCCATTGACCCAAT
ATGTTCTAATAAAAAAACAAGTACTTATAACTAACAATGACAATGAGAGGGGACAAACACAGACAACAGAACGATAAAAGACTTCTCCATGGGTAATTAA
CTCATGTTCAACAATTACATCATTCAGTATCCATCAAAACATAAAACCACGAGCAAACATTACTGGAATTGAAATTAAGCATTCTATTAAGTGCTCCAAT
CCTTCATCCCTGATCAGCTTCACTTCAGGGTACCAGGAACAGGTGAATTAACGGTACTTGATGAAGCCAATGTCCTTGGCGTTGCTGCGGAAACACTGCC
TGCAACACATCAGCCCATACTTCCTGATCAGTCCATGGGAGTTTCCACAGACCCGGCAGACGCGGGAGCCGGGCCCGTAGTTCTTGGGGTGGGAGTTCCA
GACGTTGGAGTGCCCCATCGTCGCCGCCTTCTTGTTCGCCTTCCGCCTGCCGCCGCCGGTTGCTAGGATGCGCGGGCATCCCTCTTTTTCCTCTGCTGTG
TAAACACGTGCGTGCTCCATGAAACGAGCAATCAGTGAGTGTCCCTGACAGTACCAATTGTAGCCGTCGTATAAAAGTAAAATAAAGGGCTGTGCACGAG
ACCTTGAAACAAAACGTGTACCATATGATCCTCGTGC
page-top