Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10927  (registered. 2012)
Contig Information
Length 939 bp
Clones alternative view 102 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 4
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 6
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 6
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 9
WH_XB Root 7
WH_XC Root, treated at 50 microM Al for 6h 20
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242049264|ref|XP_002462376.1|| hypothetical protein SORBIDRAFT_02g024610 [Sorghum bicolor]
Score 234
Evalue 1.00E-59
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10927
TTTTTTTTTTGCAAGGTGAAACCAAATTAACATAAGTAGATTCAACATGCATTCAGAAATGAAACTGCAAATGGGTATCAAATGTTTCACAATCTCTGAT
GTCACGGCGGCAGAAGGATTTCAAGTACTCTAAAACATTTAGCTAGAAGGGACTAAACCATTGATCATAACCACCAACAAAAATATTTTCCTTGTTTACA
GAACACCATCGCACTTCGCACTTCTGTTTCAAACAGATTACTTTGAGGTCGTCTTGTCCTTGGTCTTCTGTATTTTCAACACCTTCTTCACGATCTTCTG
CTCCTCAACCAAGAAAGCGCGGATGATCCTTTCCCTCACTGCAGTTCCAGAGAGCACTCCACCATAGGGACGGTTCACAGTCCTGCGGTTCCTAGACAAC
CTTGATCTTTTGTATTCAGTAGGCCTGAGGTGGGGAATCCCCTGGATCTTCTTCCCGGTCACAGGGCACTTGGGGCCGCTCGCCCTCTTCTTGGTGTACT
GGTACACTAGCTTACCACCTGGGGTCTTGACGACCCGCGTCTGGTTGGACTTGGTGGCATAGCTGTGCCTCTTCCGGTAGGTCAGGCGCTGCACCATGTT
TCCGTCGTCTCCGCCGCCGGCAGTAGGGGGCTTGGGCAAAGAGTGGGGGGAGAGCGCAACAAAGAGTAGCGAAGCGATCGGTGCTGGCCAGTGCTACTGC
TACCGCTAACGCTACCCATCCGGGCAGAGAGGCTGCAAGAAGTAAAGATGAGCCCCGGCCCGGCGGCCACGGGCGGAGGCGGCGGCGAGCGGCGGNNNAT
CCGGGGCCTGTTCAAGTTCGCGGACCGGGTGGACGTGGTGCTCATGGCCCTGGGCACGCTGGGCGCCATCGGCGNNNNCTGCTCCACCAACCTCCTCCTC
ATCTTCGCCAGCGACGTGATGAACTCGCTGGGGCGCGGC
page-top