Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14073  (registered. 2007)
Contig Information
Length 938 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: hypothetical protein [Rattus norvegicus]
Score 120
Evalue 0.000159699
Total Hit Count 273
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14073
AGGAGCCACTCCGGTCAGTGTGGCGTCCGGCACAACGACCCCGGGAAGGGAGTTCCCGAGCAGTGCAGCGTCCGTCACAACGACCCCGGGAAGGGAGTTC
CCGAGCAGTGCGGCGTCCGACACAACGACCCCAGGAAGGGAGTTCCTGGGTAGTGCGATGTCCGACAAGTCATCCCCGAGAAGGGAGTTCCCGGGTAGCA
TGACGTCTGACACGATGACCGCGGGAAGGGAGTTCCATGGCATTGTGACGTCAGGAACTACGACCCCAGGAACACTGACGCCCACAGGCGAGGTGGTTCC
CTGGCAGTTCATGTCCCTGCCAACATCGCGGTCGGACTTGTTAGATGCCAACAAAAATTGTGGCGATCCACACAGGTTCCGAAGCCTAGGTGGACCTTCT
CGGCGAACCTGCGGGACGACCGCAGCATCCCGAGATCAAGAAGCACGAGTAAGGCGTATGGGCTACACAAAGCCTGAGAAGACGGACATCCCGACGAAGG
CACTTGGTCGCATTCGGTTCCAGGAACCACGCGACAAGATTGGGATCATGGAAACAAGCTCCTTCGACAAGGTTGAGGAGGAGATTGTTGGGTCAAACCT
TGTCTCCGAGGCATGGCTACAGCGGCAGCAACAGCTTGCATGCAACGGCAGTAGTAGTTATTACTCAGCTATGAAGTGATAGAAGATAGTAGTAGCTGCA
TGTCGGCAGCATGCAGCACCAGCGGCAGTAGTAAAATTGCTTACCTAAGAAGTAAATAAGCGGTTCGGCAGGTCGGCAACACTTGCGTTGCTTAGTAGTT
AAGGTAAACTAGGTAGCTAATGTTGAGCTGTACCTAGTGTCTAGGCTGGTACACGTATGTGATGAGGTGGGCAGGAGTAGAAATATCTCAGCTGCCATAG
TCGGTTGAATCACCTATAAAAGGACATGAGTCCCTCGG
page-top