Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14070  (registered. 2007)
Contig Information
Length 729 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_013941 [Oryza sativa (japonica cultivar-group)]
Score 221
Evalue 1.96218e-16
Total Hit Count 263
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14070
TTTTTTTTTTACTCAACTTGCACAATCTGTATATCACCAGATATCTTAACGACGACGACGACTAGCGTAACAAGAATAACGTCAGCATAGTAAATTCATA
ACCAATATAGCAGGCATCAGCTAGAAGTATACTGTATGCAGGGGGAACATCATCGCGATAAATCATAAGGTAGGTAGCCAGGTAATTTTCCATTACTCAA
AATTTTGATCTAAGCATCTATCTTTCTCTCCCTCTCTCTCTCAATAGCTGCCTCGATCATCAGCGACTTCAGGGACTCGACTCGCTCCTGGCAACAAACC
AGCTGGGTCTTGACGACGAAGCCTCGTCTCCACCATCCAGAAAGTCAGCAGCAAGCGAGCCCCGGGGTCTTCAAAAGGCAATCGACCAATCTTCTTCTTG
TGTGGCCTCAGTGGTGATCTGTTTCTACTCCGCCTTCTTGGTCCGGAAGTTCGACCTCATTGACGCAATCTTTTTCTTGCACTGCACCACTGTTTTACCA
GGGACAGCAGCAGCTACTCGCTCCCATCTTTGGTTTGCATCCTTGGGAAACGCCTTCAAAGCTTGAACAACGGCCAGCACCTGGGCCTCTGACCAGGCAT
CTGGATCTGTTGCAGAAGGAGCTTCTTCCCTCGTGCCGAATTCGGCACGAGGGTTACTTTCTTGGTTGCAAAGTTTGATGGTATTCTTGGGCTTGGGTTT
AAGGAAATATCTGTTGGCAAAGCAGTACC
page-top