Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14044  (registered. 2007)
Contig Information
Length 660 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Solanum tuberosum] >gi|77745497|gb|ABB02647.1| unknown [Solanum tuberosum]
Score 667
Evalue 3.03516e-68
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14044
TCCTCCCTCGCCCTCGCCTCCCCGCCGCCACCCCACCAAAGCAGAGAGCTCCCCGCTTCTCTCCCCCACGAGGTTAGGCAAGGATGGTGAGGGTTAGCGT
CCTGAACGATGCTCTCAAGAGCATGTACAACGCTGAGAAGCGTGGCAAGAGGCAGGTGATGATCAGGCCCTCCTCAAAAGTGATCATCAAGTTCCTCATC
GTCATGCAGAAGCACGGTTACATTGGTGAGTTTGAGTATGTTGATGACCACAGATCTGGCAAGATTGTTGTGGAGTTGAACGGCAGACTGAACAAGTGTG
GAGTCATCAGCCCCCGCTTTGATGTTGGTGTCAAGGAGATCGAGGGATGGACCGCCAGGCTCCTTCCATCTCGTCAGTTTGGCTACATCGTCCTGACAAC
CTCTGCTGGCATCATGGATCACGAGGAAGCCAGGAGGAAGAACGTTGGTGGCAAAGTGCTAGGCTTTTTCTACTGAAGGAAAATTTTGTGAAAGTTGTAT
TTCAGACCGGTGTGATAGGATGTTATCTCAGGACATCAAGGTTGTCTACTTTTTGCCTGCATAGCTGCTATGCCTTTGTTATGTTATGTTGGATTCAGTT
AATTATGAGGTGCACTTTTGAATTTCGAGTCGTACCTGCGATGCCATTTGAAAAAAAAAA
page-top