Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14012  (registered. 2007)
Contig Information
Length 1105 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14368 [Oryza sativa Indica Group]
Score 1691
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14012
ACCAACCCCGCCATGTCAGAGAGAAGCGCTTCACTGATGCCATCCACAACACAGTTTCTCAAGGGGGCCGTGTTCTTATCCCAGCATTTGCTCTTGGTAG
AGCACAGGAACTGTTGCTTATCCTGGATGAGTATTGGTCTAACCACCCAGAGCTCCATAAGATTCCAATCTATTATGCCTCCCCTCTTGCGAAGAAGTGT
ATGGCTGTCTACCAGACATACATAAACTCCATGAATGAAAGGATAAGGAATCAGTTTGCACAGTCCAATCCGTTCCATTTCAAGCATATTGACCCTTTGA
ATAGCATTGACAACTTCCATGATGTGGGTCCGTCAGTGGTGATGGCAAGTCCAGGTAGCCTCCAAAGTGGCCTCTCCAGGCAGCTCTTTGACAAGTGGTG
CACAGATAAGAAGAACACATGTGTTATTCCAGGTTTTGCCGTAGAAGGTTCCCTTGTGAAGGCCATTATCAGCGAGCCGAGAGAAGTGACGTTAGCGAAT
GGGCTCACTGCTCCCCTTCATATGCAGATCTTCTACATCTCCTTTTCTGCTCATGCTGATTTCCTACAGACGAGCGGCTTCTTGGACGAGCTTCGCCCAC
CCAACATTATTCTTGTGCACGGAGAAGCAAATGAGACGGGGAGGCTTAAACAGAAGCTTATTACTCAGTTTGATGGAACAAACACAAAAATCGTGTCTCC
CAAGAATTGCCAATCAGTGGAGATGTATTTCAGCTCTGAGAAAATGGCCAAGACAATTGGCAGATTGGCAGCAAAGGTACCAGAAGTGGGAGAATCAGTT
AGCGGCTTACTCGTGAAGAAGGGCTTCACGTATCAGATTATGGCCCCTGAGGATCTCCGTGTGTACACACAGTTATCTACTACTAACATTACTCAGCGGA
TCTCCGTCCCGTATTCTGGTTCTTTTGAAGTGATCAAGTACAAGCTGAAGCAGATATACGAGAGTGTGGAATCATCAACCGAAGAACCTGATGTTCCAAC
TTTGATTGTTCACGAGAGGGTGACCATTCGCCTGGAATCAGAAAGCTATGTTACGCTGCAGTGGTCCTCTGATTCCGTAAGTGACATGGTGTCCGATTCT
GTGGT
page-top