Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10915  (registered. 2012)
Contig Information
Length 1135 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226509074|ref|NP_001141847.1|| hypothetical protein LOC100273989 [Zea mays]
Score 289
Evalue 4.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10915
ATACTACTTTAGTGATCTATAAGCAATCTTTTTTTAGTTTACAGAGAGAATATATTATTATATCTCTATTAATTCATCAAAACACACACATACAGAGTTT
TAGTATGAGAAATACAACAACGGCACTAGATAGGCGAAATTAGATCTCCTCCATCGGGGGATCAAGACATGGAGCCGGCCAACTACCGGGCGTTACTGCT
GGCCAACATTAGTTGTTGACTCTCCAGCATACCTTCCTGATCTCTGCGCCTTGCTGGTTGCCTATGGTCTTGACCCCGATTTTCCCCATAGTCTCCATGG
CTTTCTCGAACTTCCTCTCCCACGCCCCATCCATGTTCGCGTTTTCTGTCACCTGCGTTATCGTCTCCGTCGAGTTGAGCACGGCATCCGAGGTGAACAA
CACTTTCTTGTCGACCACATTCTGGTAGTACTGCTTATCCAGGACGTTGGGGGTCACATCGTCTTGGTTCACATTATCGTTGTCGTTGCCGCACTGGGCC
CTGAGTTTGGCGGCTAATGCCGAGTCCATCTCAGAGAAGCGGCTGGAGAAGGACTCGCGGCCGTCGTAGCGGCCGCCCGGCATCTGGATGTTGATCTTGC
GGTCGCTGAGGAAGTAGGACGCGTCGCGGGCGGCGTAGGCGACGATGTCAGCACATGAGACTGTGTCGGGGCAGGCGGCCTCGATCGCCGCCTTGGCCTC
GTCAATCACCTCGAACCCTCGGAGGCTGTTCTGGTTGGGAGGGCCTTCCCTCTCCGTGTCGCTGTTCTTGGAGTTGGTCGTGTTGAGAAGGACGGAACCA
TCGCAGCCCCGAACGAAGCAGTCATGGAAGAAGAGACGGATGAGCCCCGCACCAATGCCAGGATTCGCATCCACGGCCTTCTTCACGGCATCCGTGACGA
TCTTCTCCGCGCCAGGGCACCTGGTGTTGTAATAGCCGGAGGTGAGCCCTGACCCCGAGGGAGCAGGTCTCCTCTGCCGCGTCTGAACGTCTGGCGTGGG
GCGACAGAGCACCGGGTTGTAGGTGGGTAGCCTCAGCCAGCCGTTGAAGCAAATGCTAGCGGCCTCGGACGCCGCCGGCCCGGCGAGGAACGCGGCCAAG
ACGACGAGCGCTGCGAGCTTAGTCGCCATCTTCCT
page-top