Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13922  (registered. 2007)
Contig Information
Length 1196 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18349 [Oryza sativa Indica Group]
Score 1169
Evalue 5.30615e-126
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13922
TTTTTTTTTTATGTAAGCATGTGTATTATTTTATTGTCGTTTTATTTTGCAGTGAGTATTGTGGTAATACAAATTAGGCATGGAACAGAGCCTTCAAATT
AAATACAAATCATTACATCCATGGCACCTGTGTAGGTGTGATGCCGCTGCTTCTAGTAATAGTAGTTCTGGTTGGTGACTCTGCAGTTCTTCCTTATCTC
GTAACGGGTACTACCCTCGGCCGGGAGCTTGCTGAGCTTGACCATGGCGGCGGCGAAGTCGTTGTTCCACTTGGTGGCATTGTTCATGTACTCGGCCATA
TCGTCCCCAGCTTTGCTGTCGGTGCGCATAACCCAGTCGGACTTGAAGAGCACCCTGTTCTGTAGGTTGGCGTGGTAGTAGCTGTTGTCCAGGGCGCCCT
TCGCCGCGGTGTTCACCCCCGTGGTGTCGTAGCCGGAGTCGTTCTGGAACTTCAAGCTCATGTCGCGGATGTTGTTCTTCTCGATCGGATCCGACGTATT
TTGGCTCTTCTTCTGATCCTCGACGTCCTTAACGAGCGCCTGCTTGTAGCTGTCGTCGATCGGGGTCGCGGTTGAATCGTTGAGGCGGTCCTGGAAAGAC
GAGAGGTGGGAGACGCCGATGGAGTGCGCGCCGGAGAGGATGACGAGCTCCTCCTGGGTGAAGCCCTTGTTGGCGAAGTTGTCCTTGAGCTGCTGGAACT
CAAAGGTGGATTGCGGGAAGATGGCGTCTGCGGTAGCATCCGACGAGACAATGCCGTCCTTGCGCCCTGAGGGAACGGAGTAGGCGATTTTGCCGCCGCT
CAGGTATCTGGCCGCGTCACGCGCGGCGAAGACGACAATGTCAGCGCACGAGACGCTGTTGCCCAGTTTGTACTTGATGGTGTCGATCAGGTTGAAGCCG
TCCAGGCCGATGTTGTTGATCGCCTTCTTCTCGGTGTTGCCACCGGATGGCGTCTTGTCCAAGAGCACCGATCCATCGCAACCATTAACCCAGCAGTCGT
GGAACACCAGCCGGACGAGGGCCGCGCCGATGCCGGGGTTGCCCTTGATGGCATTCTCTACTTCTTTCCTTACGGTGCCCTCCACGTCCACGTAGGCGGC
CGCCGATTGCCCGGCAGAATACGCCAGCAACAGGCACAGAGACAACAGGGCGGCGCCGGCGTTAACCTTGGCCATCTTAAGCTTCAGCTCGAGCTC
page-top