Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13838  (registered. 2007)
Contig Information
Length 1085 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0387900 [Oryza sativa (japonica cultivar-group)] >gi|108708529|gb|ABF96324.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|108708532|gb|ABF96327.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113548733|dbj|BAF12176.1| Os03g0387900 [Oryza sativa (japonica cultivar-group)] >gi|215713510|dbj|BAG94647.1| unnamed protein product [Oryza sativa Japonica Group]
Score 796
Evalue 1.53693e-84
Total Hit Count 35
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13838
AATCCCTACCAACAGCTGACGAGCAATTCAATGACAATTATCCATTCAACGAGCAAAAGAATGTTAATGTATATGGAGAACAGTCTTACCATGGGGGCGC
AATGGAATTGTTGTCCACTGACCAGATATGCAATGGAGATGGAAACATTGATATGATTGGCGAGCGATATTCATCAGAAAATGCCTTGCAACAGTTGGAG
GGCAGGAAGTTTTCTGTATCTTCAGGATCTCAATTAAGCTCCTCCCAGAATTTACTGAAGCAAAAGCACCACTCAGATAAAACTTCACCAAGTAATATTA
CTTCTGATTGCTATTCAGATAGAAACTGCCAGTTCAGTCCATCTATATCTTTTGCACAGAGGAACTTGATGGTTCAAAAACAAGTGGCTAATTTGCAACC
AGGACAGCTCATAAATGATGAAGGACAACTTGGTCAACAAACATTGACTAGAAGAGCTTCATATCCTTGTGAGAACTATGAGGTTGAAAAGAAGGGCTTT
GGAAAACAAAGTAAGGATACACTGGGTACATCAGTAGTGGTGGATGGCTCTTTTGTGTCGTCTCTTTCTTCTGATAATTCTGTTGAAGAAAGCAGCTTCC
AACAACTTCAGGATGCAGTTAGTCAGTTGGACGTGAAAACCAAACTGTGCATTAGAGATGGTTTGTACCGCCTGGCAAGAAGCGCGCAAAATAGACCAGT
TTTCCCAAATGCGATGAATAGACATGAAGGAAGCCGGGATGTAAAGGACACACAAAGTATGGAAACTTCGGGCAAGTTTGTTGATCATAGGAGCATTGAG
ACGCAGACAAATCCAATTGATCGTTCTATAGCACTCCTACTTTTTCATCAGCCATCTCAAGTGGCTGGAGCTGTTGATAATCCTCGCCACTAAAATCTCA
TAACGAGAACCACAAGGCCTATGCTAAAAACTAGGTTGGTCAAAGTTGCGAAAATTACTGGAGATGGCTCGTGGAAATTCAAGGATCAATCGTCTCCGTG
AATGCAGGAGCAATCGTGAATGTTTATCGGATATGGTACGGTATGTACCGTTTTAATCGTTAGTCGGCTGCAAGCAAAAAAAAAA
page-top