Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10895  (registered. 2012)
Contig Information
Length 964 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|4165490|emb|CAA10664.1|| beta-tubulin 2 [Hordeum vulgare subsp. vulgare]
Score 469
Evalue 2.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10895
TTTTTTTTTTGAAGAAACAGCAAACATTGCATTAGGATTCAGAGCCAGACATATTACAAACCTGCTACTAAGATCTCAAGTTCACCAACAAACTGACTAC
CGGATTAACCCGACACAGACAAACTACACAAGCAACAAGTCCACGACACCCCGAAGACGACGGGGGCCAGCAAGCGCGAAACACACACACTACTAGTAGC
AACACGGAGCCATCAGAAATAGCCCCGGGCAACGATCAAGGAAGATCCACGGAACAGACCTCGCTGGCCCCTACTCCTGGAGGTCGGCGTCGTCCTCGTC
CTCGTACAGCTCCTCCTCCTCGTCGGCGGTGGCGTCCTGGTACTGCTGGTACTCGGCGACCAGGTCGTTCATGTTGCTCTCGGCCTCGGTGAACTCCATC
TCGTCCATGCCCTCGCCCGTGTACCAGTGCAGGAAGGCCTTGCGCCGGAACATGGCCGTGAACTGCTCGCTCACGCGCCGGAACATCTCCTGGATGGACG
TCGAGTTGCCGATGAAGGTGGACGCCATGGACAGGCCCCTGGGCGCGATGTCGCACACGCTCGACTTGACGTTGTTGGGGATCCACTCCACGAAGTAGGA
CGAGTTCTTGTTCTGCACGTTGATCATCTGCTCGTCCACCTCCTTGGTGCTCATCTTGCCGCGGAACATGGCCGAGGCCGTCAGGTACCGGCCGTGCCGG
GGGTCGGCGGCGCACATCATGTTCTTGGAGTCCCACATCTGCTGGGTCAGCTCCGGGACCGTGAGGGAGCGGTACATCTGGGAGCCGCGTGAGGTCAGCG
GCGCGAACCCGACCATGAAGAAGTGGAGACGCGGGAAGGGGATCAGGTTCACCGCCAGCTTCCGGAGGTCGGAGTTCAGCTGGCCGGGGAACCTCAGGCA
ACAGGTCACTCCGCTCATGGTGGCAGAGATCAGATGGTTCAAATCTCCAAAGCTGGGAGTGGTC
page-top