Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13536  (registered. 2007)
Contig Information
Length 1200 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit sorting nexin 8, isoform CRA_a [Homo sapiens] >gi|119607642|gb|EAW87236.1| sorting nexin 8, isoform CRA_a [Homo sapiens]
Score 88
Evalue 1.19002
Total Hit Count 26
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13536
GTGACCTCCGGCGCCGTGCAGCACGCCCCCGAGCTCCCCACGGTCCACGCGTCCCTCCCCTCCGGCCAGAGTCTCCGCTCCCGTCCTCTACCGCCCGCTC
GCAAGCCCATCCCCCATGGCTAGGGTTTCGGGTAGGGCTTCGCAGCCGCGTCTCCGGCTGCCCCAGGGGAGAAATAAGGGGAGGTATAGCAGGGCGTTGG
ACATTTGCGGGAGTGGGGGAGATCGATGAGGACGAGGACTGTCTGGTGCACTGCTGGTGCGGGGAGGGCAGGGGAGAGGGATGGCTGCTGCGCTGCTGTT
AGCTGCATATAGGACAGACGATGAGCGAGCAGAGGATTTATCCGGGACCTAAATTTGGCAGGCAAATGGGTGAGCTCTCACATCCCTCTCGGTCTCCTTT
GATTTGTTGCAGATTTCTTTGAAGTCCATGACCTCTCTCGGGCCTTGGCAGTGGCGAGCTAGGTGCCGGCGAGGTAGGCGACATCATCAACGAGGGCCAT
CATGGCCTCCACCTGCGCCCTCTTGCAGGTGGACTGCTGGTCATCAGTGCGGCGGGTCGGGCTCTTGCAGCAACATCTACGATATTCTCTGGACGACCTG
CAGTGTTGCTCTTTGGGGATTCCTATGGGATCTATTTTTGATTGGTCAAAGCTGGTATGTTGGCCACCGGTTGGTTTAACATGATGCTATAATGCGCTAC
GGAGAGATATGTTATTCCAGTACAAGTGGCCGGTCAGTTAATTTGAGGATTTTTGCCTTTTGTTCTTCAGGCCTATAGCTTTGTGGTTTCAGTTCGACAG
TTAAAAGTTGCATTGGCTTGTAAAAATTCATGTGATTGGACCAGGTGAGGATGATCTCATATGGAAAATACTGCTCCATGGTATTAAAATCTGTTATAGG
TGTTGGAAGTCAATGCTAGGAGCTCCTGGGATGTGCTCATGCATGCTTGGTCGGAACTTTTCTTTTGAATCAATTGATGAACCGATGGCATCAAATATGC
CGTATGTGTACTCCACTACGTACGACAGGGTGGAAACAAGTTTGATCGATGGAGATGGATTTCTATCCTGTTGGTGCAATTGTATGTTCAGGTGGTTCTT
TCATGTCCGTTCTCTCTAGCTTCTTGATGTTTTCTTTCTCAGGTGTAATTTAGTTGCCATTTGTAATAGCCAAATTTTCATGTCAAACATGATTAAAGAT
page-top