Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13478  (registered. 2007)
Contig Information
Length 469 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Laccaria bicolor S238N-H82] >gi|164642266|gb|EDR06523.1| predicted protein [Laccaria bicolor S238N-H82]
Score 87
Evalue 0.247174
Total Hit Count 7
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13478
CTGCTGTGCAAGATGATACTTATAGTCTCCAGGTGCTTCCATTGCTCCATCACAGTGCCGGTGTTGAAGGACCTCCACGTCTAAGAGTGTTGGAGCCTAC
GATGCCTCCTGTGCCTGCCCAATTAACAGTGTTCCACCATACACCATAGAGTGCCTTCCTCAACATTACCTTGTTAAGAATGTTCCATCATACATCCATA
CCATAGTGTCCATCCATAACATACATGCCACCCACGTGCATACCCCTTCCTCCGTATACACTTGCATGCCATCTATATGAGTTAATTTAGAGTTTTTTTT
CAAATAAAAGTCTAATTTCCCTGGTTATTGTCGACCGCCACTTTGTCTCCCGTGGAATTAGGTTTAGTTTTCCTTGTTCCAAAACATTTTATTCGAGTGT
GTTGGTGATGTATGTGTAAGGTATGTAATGCTGGTGTTTAGCATGCGATATGTTTAATTAAAAAAAAAA
page-top