Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13462  (registered. 2007)
Contig Information
Length 717 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit epoxide hydrolase, putative [Arabidopsis thaliana] >gi|3193297|gb|AAC19281.1| T14P8.15 [Arabidopsis thaliana] >gi|7268994|emb|CAB80727.1| AT4g02340 [Arabidopsis thaliana] >gi|20856515|gb|AAM26670.1| AT4g02340/T14P8_15 [Arabidopsis thaliana] >gi|23308303|gb|AAN18121.1| At4g02340/T14P8_15 [Arabidopsis thaliana]
Score 397
Evalue 1.52809e-64
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13462
TTCGTGGTTGGACACGACTGGGGCGCACTCGTGGCATGGCAGCTCTGCCTGCTCCGGCCGGACCTTGTGCGGGCGCTCGTTAACCTCAGCGTGGCCTACC
ACCCGCGCAGCTCCGAGGGGAGCCCGCTCCAGGTCATCAGGGCCTTGTGCGGGGAAGACCACTACATGTGCCGTTTCCAGGAGCCTGGAGTCGCTGAAGC
CGAATTTGCTCTATACGACAATAGTCATAAGTTTAAGACGGTCTTTGGAATGCGCAAACCAGCTCCTCCTATTCTACCCAAGACAAATTTGAGAAGACAG
GGTTTACAGGAGGGCTTAACTACTACAGATGCATGGACTTGAATTGGGAGCTTTCTGCACCATGGACTGGAGCTCCAATAAAAGTAGCAACAAAATTCAT
CGTTGGGGACCTTGACGTTACATACAATGTACCGGGGGTGAAAGACTACATTCACAAGGGTGGCTTGAAAGCGAGCGTGCCGAATCTGGAGGATGTGGTT
GTCATGGAGGGAGTGAGTCACTTCTGCAACCAGGAGAAGCCTAATGAGGTTTCAGATTACATCTGCGAGTTCTTCAGCAAGTTCTGATTATATCAAGAGA
GTCTCGGCGAACCTACCTGTTTCGGTTCTGTTTATGTACTTATAAGTTGTTGATTACACATGCCATGATACTGAAATTTCTCTAAATAAAACCATGGTCT
GATTGTCAAAAAAAAAA
page-top