Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13453  (registered. 2007)
Contig Information
Length 407 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit epoxide hydrolase [Arthrobacter aurescens TC1] >gi|119951629|gb|ABM10539.1| epoxide hydrolase [Arthrobacter aurescens TC1]
Score 79
Evalue 2.07144
Total Hit Count 4
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13453
GCGGTTACTACAACAACAACAACAACGAAGAAGGGTACTACCAGCCGAGGAACTTCAACAACAACAGGGGCAGGGGCGGTCGGTCTGGCGGCGGCAACTC
TTACTACGGCAACCAGGGAGGCGGCGGCGCGCAGGGAGGCGGCCACGCGTACGCCGAGAGGGTTGAGGCAAACGCTTAGTTGTTGAATTGTTTTGCTTGG
GTGGAGGTCACGAGAGGGAGAGAGAAGAGTCTGGGAGCCATTTTGTTATTATAGAACTAACTTAGCCTGTTATTACGTCGCAATCCGTCACCCATCTGTG
AGTTGGTTTTGTTGGTCCAATCCGATGACTGCATATGGTTGGTCGATAAATGTGGAATCTTGGTCGAAAGTAGCTTCAGGTCATGTTTGTTGGTTCCAAA
AAAAAAA
page-top