Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13384  (registered. 2007)
Contig Information
Length 740 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GH16976 [Drosophila grimshawi] >gi|193898762|gb|EDV97628.1| GH16976 [Drosophila grimshawi]
Score 84
Evalue 1.56377
Total Hit Count 69
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13384
CCTCGTGCCGTCTCTATTGGTATGAAGGCGTGGAGCGTGATTCTCTTGTTTTCAACTCGAGGCGATCAGGCCAGTAAACATGCTAAGCTTGCCTGGCTGG
CACACACGCTTAGGCACAACAATCGGCCCCGGCACCGCGCGCCAAGGCGCGCTGCAGCTTCTGGCTCTTTTGCTCCCAAGCTGGCCTCGCTTTCCTCGGT
GGTCAGCGGGAGAAGCATGAGGCGCTGCACCTCTGACCCCGTAGTGCTCAGCTCCAATTCATCAGGGAGGCCAGCGGCAAGCATCAAGTTTCCCTTGGTG
CTTCCTCATCAAGGAGGACGACTCGGGCAGCGCCGTCCTCAAGGTTGCTGTCACTCCTCGGCACTCCGCAGGATAGGCACATCCGCCACCACACCGCAGA
ACAGACGAGGATGTGATGCTCCTCCTTCTTGTGGTGTATGTGTTGGCGTGGCTTGCCGTAGTGAGGCATATCCTCGTGGGCAATGCTATTTGAAGACCAT
TCAAGTGATTTAAAAGAGAAAATGTCCAGAATGTAAGGAAGTTGAAGATGACGATCAAAAGATTGACATATTAAGCGACTGCCAAGATGCCAATAATGCT
TGCCCCTGCCATTAGTAATACCCTTGCTCTTCTTTATGAAATCTTTCCTATTATATATTGATGCATCAACTATCGGTGCAGATTGCGAGATCCCTATTTA
AATGCATCACTCAGTGGCTGGCCCGTGCATAAAAAAAAAA
page-top