Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10851  (registered. 2012)
Contig Information
Length 934 bp
Clones alternative view 88 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 4
Wh_VSCB Liquid cultured tissue 6
Wh_VWD Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 12
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 7
WH_XB Root 7
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XF Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218184182|gb|EEC66609.1|| hypothetical protein OsI_32842 [Oryza sativa Indica Group]
Score 405
Evalue 3.00E-111
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10851
TTTTTTTTTTCTCAGAAGCATGCATTCTGAAACAAAGATTTTTTTTTAACGCAAGAAAGGCGAAGATGATGCGCCAAAAACTAGTATTACACTTCCAAAA
GGTTCAGGCCGAATCAGGTACATATCCACAAGGACCAAAATTGGAGCAAGTTTGAGGGTACATATCCGTTCCGTTCACATAAAACATGCGCGGCATTCAT
TATTGCTCAATCCTAAGAGCATCAACCAGAGTTCATTCCGGAGGTTAAAACACACCCATTTTCTTCACAAAAACTCATGCAGATCCCCGTTTAGTAGGGC
TCCACCGGTGCGCGGAACTTGAGGCCGGCGTACACAGCGGCATCGCCCAGCTCCTCCTCGATCCTCAGAAGCTGGTTGTACTTGGCAAGACGCTCCGAGC
GACAGGGAGCCCCGGTCTTAATCTGACCCGTGGACAAACCAACAGCCAAATCAGCAATGAATGTGTCCTCGGTCTCACCACTCCTGTGGCTGGTCATGAC
ACCCCAGCCAGCGTGTTTTGACATCTTCACGGCCTCGATACTCTCAGTGACGGATCCAATTTGGTTAACCTTCAGCAGAAGAGCATTGCATGACTTCTCC
TGGATTGCCTTTGCAACTCTAGTTGGGTTGGTGACTAGAAGGTCATCACCAACAATCTGAACTTCCACTCCACATTCCTCAGTCATCTTAGCATAGTGCA
CCCAGTCATCCTGGTCAAATGGGTCCTCAATCGACACAATGGGGTACTCGCTCACGAATGACTTGTATACGTTCTTCAGGCTATCTCCAGATATCTTCTG
GGAACCATCGTTGTTCTCTTCCTTGAAGTTGAGGTCATAGGTTTTGTCCTTGTCATTGTAGAACTCTGAAGCAGCAACATCCATTCCAATGACAACCTTG
CCGGTGTATCCAGCCTTCTCAATTGCGGTCTTCA
page-top