Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13318  (registered. 2007)
Contig Information
Length 383 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit dnaJ subfamily B member 5 [Zea mays]
Score 115
Evalue 0.000138521
Total Hit Count 52
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13318
GTTCGACATCAAGTTCCCCGCCAGGCTCACCGCCGACCAGAAGTCCGGCGTCAAGAGGCTCCTGGGGCAGTAGGGCGTGCCCAGGGAGCCTTGTCTGTCT
GTGTGTTGTTGAACTGAACAGGGGATGTGAGATGAGATATTGCCTGCTTTTGGAGCATCGGCGATCACCGAGTTGGCCCTGTGGACTAGATGATGAGAAA
ATGTATACAATGTGAACTTGAGGTGCATAGATAGGTAAATCTTGGATCAAGTGCATTTCTTGTAAGCTTTTGGAGATCGAAGTTCGTCCGCTGGATGACT
TAATTTTTTGTTGTTCGTCTGCTGTATGGATTAGTGATGTGATAGAGGTAATAAAGTGATTTCATCATAGTCCAAAAAAAAAA
page-top