Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13314  (registered. 2007)
Contig Information
Length 1539 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14884 [Oryza sativa Indica Group]
Score 1126
Evalue 7.21912e-121
Total Hit Count 169
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13314
CGCGGTCGCGCGCGCCGACGCGCGGCGCATCACCTCCGCCGTCTCCCGCATCCTCGCCGCGCACCCGGGTCCCTTCCGCTGCGTCCACCTCACCAGCTGC
TACATGGAAGAGTTCAATGGCCTGCTCAGGCGCTGGCTCCAGATCCTCGCCGACAAGGGCATCGAGGAACTCATCCTCGTCAACCGCCCAATGCCGCTCG
GCTGCCTTCTCCACTCCACGTTCTTTCTCCCCTCCACGTTCTTAGGCATGACCACCCTCACCTGCCTCTACCTCGGCCTCTGGAAATTCCCCGACACGGC
CAGCGTCAAGCGCGCCACCTTTTTCCCTAACCTCCGTGAGCTCGGGCTCTGCACCGTCCTCATGGAGAGCAAGGATTTGGACTTCATCCTCGACAGGAGC
CCCGTGCTTGAGACGCTCTGTGTGGAAAGCAATATTTTCAAGCTTGGCCTTCGCCTTGTCAGCCAAAGCATCCGGTGCGTGAAGATCATCCTGTCCTTCT
TTGAGGAAATCGCTGTGGTGGACACCCCATGCCTGGAGCGACTCATCCTTTCAGGTGGTTGGACCAAAGACGGGGTCTGCACCAAGGTGAAGATCGGCCA
TGCCCCCAAGTTGCACTCTTTGGGATATTTGGATTCAGAAAATCATGTCCTAGAGTTCGGCAACACTGTCATCAAGGCTGGGACAAAGGTGAGCCCAAGC
ACCATGGTGCCAAGTGTGAGGATCCTGGCTTTGGATGTGCGTTGTGGAGTCCGCAGTTATGCCAAGATGATCCCGACTGTCCTCAGATGCTTTCCAAATG
TTGAGACGCTCCACATCATGTCTGGAGAAACTGGTCAACCCTCTGGCAAGCACAACCTTGAGTTCTGGAATGAGTCTGGTACCATAAAATGCATCTGCTC
GTGCATCAAGCTGCTGGTTTTCCATGATTTCCGAGGGGATCGAAGTGAGCTTGCTTTCCTCAAGTTTTTCTTTAAGAGTGCGTTGGTGCTGGAGGAGGCG
TTGATAGTGATGGCAAATGGAAGTTTCACTTCGATGGAGGATATGCTTTCCAAAGTGAAGCCTCTGGGATCCATGAAACGGGCCAGTTCAGACTCCACAA
TCACGATTAATCCCCAAGGAGGTAGCATTTGGAACTTCAAGAAAGCATCCGACTTTTCTCTTTGCGACCCTTTCGCGAACGACTGAAGTCAAAGATGCAT
GTTTATTTCATGGTCACTAGCTCTGGAAATTGTTGTGTTCTGTGGTCATATCATGGACATGCACTGTTTTCAGCTTTTCGATGATCCGCCTGACTCTTGT
TTCTACAAACATGATTAGCTTAAGTGTTGAAGTTAGTGCTACTATCTTCAATGATGCAAATGACTATCATTATGTGGTAATTGCAGAGCACCTATTGTAC
TCATGTTAATTGTGATTTCATTAGCTAGATTTGAGCTCCCGAGTATGGTGTTACATTGCACAATTGCTGCCCATACGTATGAGGCTTGATGCGGGGGAGA
ATTAGTGATATCCGAGCTAATTCATCTTTAAAAAAAAAA
page-top