Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13301  (registered. 2007)
Contig Information
Length 1186 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0546500 [Oryza sativa (japonica cultivar-group)] >gi|20146451|dbj|BAB89231.1| fertility restorer -like protein [Oryza sativa Japonica Group] >gi|113532813|dbj|BAF05196.1| Os01g0546500 [Oryza sativa (japonica cultivar-group)] >gi|215697396|dbj|BAG91390.1| unnamed protein product [Oryza sativa Japonica Group]
Score 955
Evalue 3.42355e-101
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13301
AGCCTGCAGATTCCGGCTAGGTCACGCGGCCTCCGCCGCCTCCTCCTGCTGGGTGGAGAATCTGGCATCCGGCGGTCGTACTCCACCGGTGACCGTCGCC
GCCGGGTGATCCGCGAGGCACGGGATGAGGAGGAGGACGAGGCCTTCCTCCGCACCCTCAACTTCGGGGCTGACCCAGAGAACAACCCCCTGCCCCCACC
GCCGAGACGCGGAGGGGGAGCCCCTGACCCCTCCGCCGCCGGCGCCTTCCCTGCTGACATCCTCCGACGCGCCGCCGGGAAGCAGCAGCAGCGTCCGGAA
AGGAGCTCTCAGAAAGCCATCGGGGAGTCGCTGATGGAGAAGCTTAAGCTGGGCGACGCCGCCTCCTCCACGCGAAGCAACATCGAGGCTCAGCAGCCTG
AGCACGAACCGGGGCAGCCACCGCAGACGGAGGACGTGGACGAGATCTTCCGGAAGATGAAAGAGACGGGGCTGATACCCAACGCCGTCGCCATGCTCGA
CGGCCTCTGCAAGAACGGATTGGTGCCGGAGGCCATGAAGCTGTTTGGTCTGATGCGCGAGAAGGGCGCCATCCCAGAGGTGGTCATCTACACCGCTGTT
GTCGAGGCCTTCTGCAAAGCAGCCAAGCTGGACGATGCCGTCAGGATCTTCAGGAAGATGCAGGGCAACGGGGTCATTCCAAATGCCTTCAGCTACTGGT
TGATTATACAGGGTCTGTTCAAGGGCGACAGACTGGATGAGGCGGCTGCTTTCTGTGTGGAGATGTTCGAGGCTGGGCATTCCCCGAATGCTGCAACGTT
TGTGGGTTTGGTTGATGCAGTATGCAAGATGAAGGGGGTAGAGGAGGGTGACAAGCTTGTGAGGAGCTTCCAGGATAGGAACTTTGCCATTGATGAGAAG
TCCATCAGGGAACATTTGGACAAGAAAGGGCCATTCTCACCGATTGTTTGGGAGGTAATCTTTGGGAAGAAAAAAACAAGCCGCCCATTTTGATCTAACT
AGTATGTGCTCATCCTCTCAATAGTTGAACCTCCTTCCGTGGTTAAATCAAAATGGCTAGCATGTTGTTATTACATGATGTCCACCCAGCCAGTGATTTT
GTATTTCTCTGTGTTTACATGCAATCCACCAACATTTAGTTGCTGCTTGGAACCAATAGCTCGGTGATATTTTTTTTTACCAACCA
page-top