Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13300  (registered. 2007)
Contig Information
Length 715 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit plasma membrane intrinsic protein [Hordeum vulgare]
Score 596
Evalue 6.20961e-60
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13300
CTTGCTTGGTGGATTCATGACTTAGACAGAAAGGTGGCGACGTTGGATCGATCATATGGTCGCCAAATTTAAATACAGTAGGAAAAGCAATGCGGGCTAA
TTAAGACAAAGCGATCCCATGGACCGAATTACAAGACACGGCACGCAGGACCGGGCACATGGAGGCCAACCACGTACTCGCACTACGCATATGCTGCTGC
CGACACATAAATAACACGACCATTGCGGGCCAACTGAACTGTTGAGAAGTTGCAAAAGCGCATTTCTCTCTGGATGGGCACAACACAGGTCGCCATTGCT
TCAATCTTGCATGGAGCTGACGTGGATGATAACTTGTTACGCGTTGCTCCTGAAGGAGCCGAGGGCCTTGATGGCGCCGGCCCTGAGGATGTACTGGTGG
TAGAAGGCCGCGATCGCCGCGCCGATCATGGGGCCGACCCAGAAGATCCACTGATCATCCCAGGCCTTGTCCTTGTTGTAGATGACGGCGGCGCCCAGGC
TCCTGGCCGGGTTGATGCCGGTGCCGGTGATGGGGATGGTGGCCAGGTGGACCATGAACACGGCGAAGCCGATGGGGAGGGGCGCCAGCACCGGGACGTG
AGAGTCGCGCGCGCTGCGCTTGGGGTCGGTGGCGGAGAAGACGGTGTANACGAGCACGAAGGTGCCGATGATCTCCGCGGCGACCATCGTGGACATTGAA
GTGGGACTTGGCCCA
page-top