Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13292  (registered. 2007)
Contig Information
Length 894 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit s-adenosylmethionine decarboxylase proenzyme [Oryza sativa (indica cultivar-group)]
Score 669
Evalue 3.19802e-68
Total Hit Count 320
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13292
TTTTTTTTTTAACGGAGAACTCCAATATTTGATTGAACATAGTGTCAAATACAATCTTATATTATGGGACGGAGGTAGTATGAGTTACAATATCATTCTC
CCCATAAGAGTATTGGCGACAGACATAAATATTTATTACATTCTCCCCACAACAGACTCTTTTGCTCACTATGGCAGACGCAGCAGACCATCTAGAGCAA
CTTATTCGGCAGGAACGATGACAGAAAAATAATAAAAGCAGTAAGACGGGATACAGTAGGCTTTGCCGGTCACCCGGCCAGCTGCTTAACCGAAACTACC
ATAGCAGGACACCATCTCAGAGACTTCAGACGTCTCTGGAACCGCAGACTTCTCTTCAGGCAGCAGCGACACCTTTCACGGCCACCTTCTTCTCCACTCC
CCAGATGCACGTGTCCTCGCCCTGCGCGGCCGCCTCCATCCCGTCGCTGCTCCAGCCATCATCCAAGGTCGACCTCGGCGACACGGCGCCAGGGGCAACC
GCACTGAAGCTCTGGTACATGAGCAGGCCACCTCCCGGAAGCTCCTGCTCGACGACATCCTCGAGCACGTAGGAGGAGCCAGCCTCCGCACCGCCCGCCC
ATGATTTGGCGAAGCCGTGGCCACCGAAGATGGTGACGGCGACGGAGAAGTCTGACGGGCGGAAGCACGACAGCACCCTCTCGATCAGGTCACTGTAGAC
CAGGGAGCCAGGGTTGAAGTTCATCGCTTCATAGCTCGCGTAGCTGAAGCCCTCCTCAGGAGTGACGTGGATCGTGGAGGCTGCGGGGCCGCAGACGCCG
TTCATCGAGTAGCCGCACGGGTCGAAGTCGAAGTCGCAGATCTCCATCTCGGGGATGATAGCAGAGATCCCCGAGACCTTGGTCATCTCCTTGG
page-top