Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10840  (registered. 2012)
Contig Information
Length 983 bp
Clones alternative view 355 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 5
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 7
Wh_RDr Root of dessiccated seed 20
Wh_SHC Shoot grown with cold treatment 14
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 6
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 12
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 41
WH_XT Roots, 18 day old plants were grown hydroponically 26
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 28
WH_SP 1
WH_XA Root 6
WH_XB Root 25
WH_XC Root, treated at 50 microM Al for 6h 23
WH_XD Root, treated at 50 microM Al for 6h 47
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|5923877|gb|AAD56395.1|AF184059_1|AF184059_1 glutathione S-transferase [Triticum aestivum]
Score 432
Evalue 4.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10840
TTTTTTTTTTGAGATAAATACCTGGGCACAATTTATTATTAAACCAGAGCACAGGAATGCTCATTTCAGTACAAGATTAGACAGGATCGCAAGCACAAGC
CTGAACAATCAACACGAGGAGACATCACAAGAACACACACTCGTACAGGCACACATCAGGGGGGACACACCTCGGCTTATTTCGCGACGAACGAGCGCCA
GAAACTAAGATCATGGCTTCATCAGCGCAGCGACCTTCTGGACGGACGGCCTCGCCAACAGGTCAGTCCACCAGGCCTTCACATGCGGGTACGCGTCGAA
CAGAGATGCGTAGGGTGTAGCCGCCAAGCACAGGGTGACAGACACATGGTTAAGGTCCGCAAGACTGAGGGAGTCTCCAGCCAGGTACTTGGACTTGCTC
AGGTGCGCCTCGTACACTGCCAGCACGTTCTTGATCTTAACAAGGTTGTCGTCAATGACCTTCTGGTCAGTGGCTCCCCCAAGCATAGGATGGATAAGGC
ACTCGAAGAGAATGGGGCTCAGAGCGGCGGTGTACTGATGGGCCTCCACCTCGAGCCACACATCCACCATTGCTGACTCCTTGATGTCGCCCTCCTTCAA
CAGCTCTGGCTTGTTCTTGCGGCACGCATACTTGCAAATAGCACGTGATTCGAAGACGTACAAGTCACCATCCTGCAAAGCTGGCACCTGGCCAAAGGGG
TTCCTGGCGAGGTGGTCGGGGCTCTTGTGCTCGCCGGTGCCGAAGTTGATGGGGACGAGCTCGTACTCGACGCCGGCCTCCTCCAGCGCCGCCACGCACC
TGGTGACGTTCCACGACAGGGTCGCGCCGTACAGCTTCACCGGAGCCATCTCTTCTCACTCTGCAACGCACTCGAACCTTTTTTCTCTCTTCTTCTCGGT
AGGTAAAGCCGCTGCGGATGGGATGGGATGGAGAAGACCACGCTCGGGGTCTCGGCTAAATAGGCGACGGAGGGTTTGCTCCC
page-top