Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13167  (registered. 2007)
Contig Information
Length 1125 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24143 [Oryza sativa Indica Group]
Score 1152
Evalue 4.5506e-124
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13167
AATGTAGATCTTTGATTGGTAGCACTAGCAATAATACCCCTAGACTAGAAAATCAACTGAGTGAGTTCCACATCTGTGAAAAGCCACTCTCAGCTAAGTA
CTCGAACCCATCTTGAGCAAACACACCACCCTGGGCAGGCGCCTCCCTCTTCACGTTGCCTTGCTCAAACCTGGTGAGCTGGCTCAGCGCGTCCTTGATC
GCCTTCCCCATGTGCTGCTGCTCCTGATCGGCAGCCATGGGCGCCATCGCCATCACCGGGATGTTCATCGAGGCCGACGACGACGGGTGAGAGGAGGGGC
CATTGGAGAAGCAGGGCACTTGCTCATAACCCTCTAGGTTTTGCACCGTGGACATTCCAGGATGGTCAAAGGCAATGTAGTTGTCAATGAGAGGAGGCAG
TGAGGTTGCGGCTGCACTGTCAATGTTGTAGTTGCTCCCTGTGGATGGTTTGGCAATGGTTGTCCTGGTCTTGTAAAAAACCCTACACAAGACCCAGTCC
TCCTTGAGTGGCAACTTCATCAGATCGCCTTGCCCTTCCTTGCGGAATTCGTGCATGACCCATTCAGTCTTCTTCCCTTTAGGGGCTCTACCTTCATAAA
ACACCAGGGTTTTTCTCATGCCAACTAGCAACCCTTTCCGGCTTATCGCACGGTCTTTCCCTGTGGCCTTCCAGTAGCCTGATTCAGTTGCTCTATTTGT
TCGCTGGCCTGTAGCGTACTTCTTGTCCCTTAAGCTGTAGAAGTACCACTCCTTGCCGCCAATGCATGCGATTTCGGGGAGGTCCCAGGGCTCGATCTTG
TTGAGGTCGACGTCGACCATGGCGGGGCAGCCGTAGATGCTCGCCACCGCGGCCGCCGCCCCTCCGGCGCCACCGCCGCCGAGCTTCCTGGACAGGTAGT
CGAGCACGAGCTCGTCGTCCCGTGGGTGGAACCTGAAGCCCGGCGGCAGCCTCGCCTCCACCATGCTCAGCGAACTCATCGCCGCCACCACGCACGCAGC
TCGCCTTGGATCCCCTCGGATCCCCTCGGATCAAGCGATCAACGAGAGGTACAGAGGACCGACGGCTGCTTCTGCTGCCGATCTCGGCAGTGGGACCAAC
ACAACACAAGAAGCAGCAGCTGGCT
page-top