Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10823  (registered. 2012)
Contig Information
Length 1097 bp
Clones alternative view 90 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 6
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 7
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 4
WH_XA Root 8
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 11
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|12229949|sp|Q9XHS0.1|RS12_HORVU|RS12_HORVU RecName: Full=40S ribosomal protein S12
Score 277
Evalue 1.00E-72
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10823
TTTTTTTTTTGTCAAATGGAACAGGCAACAGCAACAGAGCAAAACATCAAAATTGTGATATTGCAAAGAGAAATATATTATCAGCTCTTGATGATTTACG
CTGAAGGCAGCAGCTGCCAGATAAACAAAGGTTCAAAGGTCCAAATCGACGATATCTGCTAGGCTCACACTTGAAACTTGGAACAATAGGAAGCCCAAGA
ATAAAGCATAAATGAAACCGAGGACCAAAATGCCCAACACAAGTGCATCATGAAACATTCTCATCTAGTGAGACTTGACATACTCCTGCACGATGTTAAG
GCCCTCGGATTCTTCACCGTAGTCCTTGACAACAACGCAAGAGCAGCCCACAACCTTCCTTGCCTTGCCCTCAGAGTCAATCTTGCAAAGCCCTGCCCAC
TCTCCAAGAGTTTTAGCACTTGGCACAGTAACCAGGTGAACATTGTGCTCAGCGCATAGTGCCTTAACGAGCTTCACGTAATCAGGCTGGTCACAATCCT
CAGCCAGCACACAAAGCTGAGCAGCATGCTTCTCAATGGACTTGGCAGCCTCACGGAGCCCCTTCACAAGGCCATCATGAGCACTTGACTTCTTCATGAC
AAGCTGTAGAGCAGTCATCAAGTCCATTGGCTCACCAAGAACCAGGGTAGGTGCCTCTACTGGGGCAACAACTGGTGTCGGGGCTTCTTCCGCCATCTCG
TGCGCTCCAAAGGCCACCGAGGCAGCTGCGAAGGAGGGAGATCTGGAGCCTTGGGACCTTGGAGAGCGGCGGCGGTAGGGTTTTCGCGTGCCACCCCCTC
TTCCAAGATGTCGAAGCGAGGGCGCGGAGGATCCGCTGGAAACAAGTTCCGGATGTCGCTGGGTCTGCCGGTGGCAGCCACTGTCAACTGCGCTGACAAC
ACTGGTGCCAAGAACCTGTACATCATCTCCGTCAAGGGAATCAAGGGGCGCCTGAACAGGCTTCCTTCCGCCTGTGTTGGTGACATGGTTATGGCCACTG
TCAAGAAGGGAAAGCCTGACCTGAGGAAGAAGGTCATGCCGGCTGTCATCGTCAGGCAGCGCAAGCCATGGCGCCGAAAGGACGGTGTCTTCATGTA
page-top