Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13061  (registered. 2007)
Contig Information
Length 1055 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_000172 [Oryza sativa (japonica cultivar-group)]
Score 830
Evalue 8.95291e-87
Total Hit Count 224
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13061
TTTTTTTTTTGTCAAATGTGGTTGATAGATCATGCATGGGAAATTTGGAACTTCCTCTGCAGTTCGAGAGGAGTAAAAAGAGTCTGTGAGCATTCTGTAA
ACCACAACAGCTACCAATCCACAACCACAAGGCCAACAAAATTCCCCACCCTTCATGTTTTTTTGCCTGCCTCTCGATTCAATTCCGTATGGGAGCACCA
AGAATTCCACCAAAGGTTCTATAAACATCCTCACAAGGTCGTTCGACTGATCGCTACTAATTACACTCCCTACAAGCTCAGGTAAAATCCCCCACCGAAA
GCTCCCTGGCCTCCAACAATGCTGGGAGCAGTGAGCACTTGAAGCCATCAGAGTCACCAAAAAATCTTGAAAGAATAGGCACGCCCCTCACCTTGGCCCT
GTGCGCACAACCCAGCTGCAGCAAAAATGCTCCCACGGGAGGCGGAAATGCCGGAGTTCTGAACACGTGGAGAGCCACTCGATCTGTGCAAAATGAGACG
CGCTCGACTGCCGGAAAGTGCATGCAGCCTCGCGGTTCAGTGCTGCTATTGCGCGCATGAGCTGTTGCTTGACTTGGATTCTTCCAGGATCCGGTCCATG
TATCTGCGGAACTTCTCGGCTTGGGGGCCGGGTCTTACGATGTTGACGTTGCTCCACTGGGAGCATGGATCGCTGAACCACCTCTTCCTGCCTGTGCACC
ACGCTCCGGGAACAGGTCTGTGACGCCATCGCTGGAGTATTTTCTCATCAATCCTGTCCAACAGATGCTCTTTCTCTCGGAACTTCCTAGCAAAGGGCAC
TCCGCTCTCCACAATCTCCTCATAATGTGTAATGTTTAGAAACCGGGGTTCCATCTGAGGTGGGTCGTCCCATGCCACGTACCGCAAGTCATTGTTCACC
GTGAAGTTACGGAAGTCCGAGTTGCATGCGACTGAGTGGAAATAACCTTCCAGAGGCAACATCACGTTCGTGAAGTACATGAGAAGGGTCCGAGGGAGGT
TCTCCCATCCGAAAATGCAGTACTCTATAAACCTCCGATTCAGAATGACCCAAGG
page-top