Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13060  (registered. 2007)
Contig Information
Length 725 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_010406 [Oryza sativa (japonica cultivar-group)]
Score 578
Evalue 7.80356e-58
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13060
TTTTTTTTTTATCTATGTATAAAACAGGGTGTGAAATCTAACTAGAACTTGAGGTGAACAAAAGACAAGTTTTGATGTAGATGCCAACAACGCTCTACCT
AATCCATTAGAAAGCTACAGATAACATGAACGATACATATCAAAGGATTGTCCCCCCTGCGTAACTGTGTCCTTCATGGCAAACAGTGAATAAGAAGGGA
TCTTCTCATGCAGGATTGCTAGCCTTTCAGTCTTTTACCAAAAGGTCTGATTGCTCCGGGAGTTCACTGTCTTCGCCATTTCTGCCAAGTTCCTTCTGGC
AGGGGACATTCATCGTTTGCTGCGAAGAGATAATTCCCGCAATGGCTTTCATGGCAGCAGCAGCCCGGTCACTGCTGACCACTTCCTCACCAGATCCCTC
CACAGGTTCAGTAATCTTACAAGGACCATCTTCATTCTGCTGTGGCGGAGGCACAAAAAAGGGTATCTTGCCCCTCTGCCAGTCATGAAGTACCATCTTG
GCTGCTGTTGTCAGATCAGGTTCCCCACCCTTGAGTAGCTTTCCACTCATCTTGCTCAGCTGGACGAGAAAATCATTATCATCAGCCCAGTCTTGTATTT
TGTAAGCTCTTTGTAGATGCTCCTTCTTTACACGCCTTAGAACTTCCCCAATGTGCTCANAAGCATCATCCAAATTTGTCACCCGTACCACACCCTTAAG
AACTACATCAGTCTCTGTATCATTG
page-top