Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12993  (registered. 2007)
Contig Information
Length 864 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10925 [Oryza sativa Indica Group]
Score 761
Evalue 6.52027e-79
Total Hit Count 166
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12993
GTTAGCTCATTGTATAATACGTGAAAAGCGCAACACTGCATTGTCAATTAAGCTAACCGACTGAACAACAAAGTGTTACATGGAAACAAATTGACTATGA
CACAAAGCCTTGTCAAAACATTCCTTGGTAACACTAGGAGCTCAGCTTTCATCTATTCAACCAGCTTGAAGCTCTGCAATAACAGACCTTACTTCCTACT
AGAAGCAAAGAACTCACCCTGACACTAACTTATCTCTCTTCCTCAAAGAAGGAACAAAACTTCATTATTCAGCAGAACACAAGTCACCTGCCGTTCACAC
CCACATGCATAGCCACTTTGAGACTCAACGCCTCAATTGTGCATTAAACATCCCGTCTTCAAGATATGTGCTGAATGAAATGCACTCAGAATCTCTCGCC
AAATCTGAAGAAGACGGTTCCAGCCCCAGTATTGTGATCTACGATGTACTCTCCTCTTACCAAGCCAAGCTTGACGCCAACACCATAAGAAGATCCATGG
CCAACGCGTCGGAAGAACTCAGTAGGGTTCCCTTTCACATCCTTGGAACTCCCAAGGTCGGTGCCATGCTCAGCAAATCCATAAACATATGTGTTCTTCA
CGGGTATGCGCACCTCACCAGCAACCTCCAGAACATTCCTAGATGCACCCAGTTCACCCATACCATAGCCCCTAACTGAGTAAGGTCCTCCAAGTGTAAA
TGCATCATAGCTCGGCAGATCTCCTACACAACCTGCATAATGACCATGAAGAACCAACACAGCTGGCAGCGGCTTGCCAACACCTTTCTCTTGATTATTT
AAATTAATGAACTTTGTCAATGTAAGCTGATGACGGTTNAAAGAGTGGGCTTTTGCTTCCAATG
page-top