Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12941  (registered. 2007)
Contig Information
Length 905 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_024159 [Oryza sativa (japonica cultivar-group)]
Score 784
Evalue 1.51495e-81
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12941
GCCGAGCTGATACAACAGTTATCATGTGTTGTTCAAAAAGATAAGAGAGAAAAAAAGATAATGGTGTCGCAAGCGTCAGGTAAACAACATGCCATCGCAC
AACCTGGATCACAGAGCATTGTAGATCACCACATCGTGAAATCACAGGGTAGAGGATGGCGCATGCAGTCGGACACCTCCATTGCAGAAACATGTTCCAA
TAACAAGCACACAGAGATCAACGGGATCGCTCAGAGTAGATACAGCAGTAGGTACATTAGGCAAACATGCGGTGGTTATTGAACAACTACACAAAGATCA
GACACTCGCAGATGCCATCCCCGCCTAGTAGCCATAACTGGTCTTCTTCATCATCCTGGCAAACTCGCCAAAATCTATCTCACCATCACCATTTTGATCT
GCCTCTTGAACCATTTCTTGGATCTCTTGGAGAGTGAAGTTTTCACCCAACTCCTTGGCAATACGCTGAATATCAACATCTGAAATCTTCCCATTTTTAT
CTTGGTCAATGATGCGGAACGCTTTTGTAAGCTCTTCTTTAGTATCCCTCTCCCCAATCTTGGCAGTCATCATGTGCTCAAACTCCTCATAATCTATCGA
TCCACTGCCATCTTTGTCAACATCAGCAATCATCTGATTGATTTGCTCTTCTGTCATCTCAAATCCCAAGGCTCTCATCGCAACATTCAGCTCCTTGGCA
TCGATGGTTCCTGAGTTATCGGTGTCAAAAAGATCAAACGCTTCCTTTATTTCCTGCCTCTTCTGTTGCGTGAGGCCATGAGGACGAGTTCTAGGCCTCT
CCCTCCTTGTCTGCCCCTTCATTGTAGACATGGCTAGAGAGGAGCGTCGCGAAAGGTGAGCCGCCGACGAATAGGGTCGCCGCCCGCGTAGATCTGCCGG
CGCCC
page-top