Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12918  (registered. 2007)
Contig Information
Length 588 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit allene oxide cyclase [Hordeum vulgare subsp. vulgare]
Score 574
Evalue 1.40239e-57
Total Hit Count 52
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12918
ACGGGAGCCTGGACAAGCGGATCGGGATCACGGCGGGGATCTGCATCCTGATCCAGCACGTGCCGGAGCGCAACGGCGACCGCTACGAGGCCATCTACAG
CATCTACTTCGGCGACTACGGCCACATCGCCGTGCAGGGGCCCTACCTCACCTACGAGGAGTCCTACCTCGCCGTCACCGGCGGCTCCGGCGTCTTCGAG
GGCGCCTACGGCCAGGTCAAGCTCAACCAGATCGTCTTCCCCTTCAAGATCTTCTACACCTTCTACCTCAAGGGCATCCCCGACCTGCCAAAGGAGCTGC
TCTGCGCGGCGCCCGTCCCGCCCTCCCCCACCGTCGAGCCCACGCCCGCCGCCAAGGCCACCGAGCCACACGCATGCCTCAGCAACTTCACAGACTAGCT
ACCTTAGCTTAGCCCAAAATATCTATTATTGCTCCTGCTAGTAGTTGAACTTGCGTGCGTGTGTTGCAACTTCACCGACTAGCTAGCTCTAGCAGTCTAG
CTAGGCAGCCCAAAATATATCTATGTACGACCAATTCCTTGTACCAGTGTTGAATGAATGTCCTTGCAACGGTGGAATAATTTCAAGT
page-top