Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12900  (registered. 2007)
Contig Information
Length 1039 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_SHC Shoot grown with cold treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein kinase 1 [Aegilops tauschii]
Score 1400
Evalue 7.02211e-153
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12900
GTTATACTTATACTTTATCCACAGCATCACTACGAACAACGCTTACAGAAACACATGTAATCATACAACAGCACACCACAACCCTCTGAAACAAATGGCA
CAACAGAAGGATGAACACATTACAAACACAAAGGCCACACCACCAAGGGGAACCGCCACGCCTGCTCGTCACAACGCGCACACAAAGTCACCGCTGTCCT
CGACGTCCACATCGACATCATCTATGTCGTCGAGCTCCATGCTCCCTAGCCCAGGCACTGACAGCTGCCCGGCGAACTTGGAACCGTCGCCCGGTATCCG
CGCCTCCTGGATGATGGCCATGATCTCCTCCAGGGTCTGCGGGGGAGCGTTGACGCCGACCATGTGCAGGCTCATCTGGTACTCGTCGGTCATCTCGATC
GGCAGATTCTTGAGGAACCACGGGTGGTTCTTGATCTCTTGGATGGTTATTCGTTGCTCAGGGTTTGCCACGAAAATCCGGGACAGCAAATGTCTGCACT
CCATTGAAATCCGGACATAATCAGGTACTGAGTATTGTACACTGAGTATCCTAGTAATTGTCTTGCGGAAATTCTTCGGTTCGTCTGGGTCCTCAAAAGG
ATAAGCGCCCACAAGCATCACATATAGAGTTACTCCACAGGACCAAACATCAGCGACCTTTCCATCATATTCCCTTCTAGAAAGGACCTCGGGGGCGATG
TAGGCAGGAGTACCGACGGTCGATTTTGGCTGAGAGTGCAACACAGAGGACTTGGAGTAACCGAAATCACATATCTTGAGCCGGGGTGCTTCGCTCCCAT
CCAGGAGCGTATTTTCTAGTTTCAAATCTCTATGACATATTTGCATGGAATGGCAATAGCTAACTCCTGAAAGCAATTGTTGGAAGAAGAACCTAGCCTC
ATTCTCGCTAAATCTTCCAGAACCACAGATCCTTTCAAATAGCTCACCGCCAGCAGCGTATTCCATAACTATGGCCAAATGTGTGGGAGTTAGCACAACC
TCTTTGAATCTAACAATGTTCGGATGCCTCAGAGATCTG
page-top