Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10804  (registered. 2012)
Contig Information
Length 1066 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig10804
GCCTGACGGGGTGTGGCAGAGGAGATGTGGCTCGATCTGGTGGGGGTGGCGCCAGCGGGAGGCAGTGCTGGGTTCTCACGGGCAGGTTGGTGGCGGCGCT
GCGATGGCTCGGTCAAGATGGAGTCTTGCGAGCAGCGAGCTTTCGGTCATCCCTGTGCGGCGTGGAGAGCGGCGGTGCTTTCCTGGTGATGCCGGCCTGG
GATTTCTCCGTGGAGAGGCGGGTCTGATTGTCGCAAGGTCGTTCCTTGGAGTGGGCGACGGCCGTTGCGGGCAGTCCTGGACCTGGCCGGAGGTGCTGGT
TGGCTGCGGACCCTCGTGCAGGCTGGGAGTGGATGTGTGGCCGCGGTTTCCCTGCCGGGTGGTCGGTCGTTGGTCCTCGGCTATGCAGCTACTTCGGCAA
GTGCTGCGGTGGCGGCGGTGTGAGGCTTCTTGGCAGTGCTACCAATCCCATGGAGGCGTGGCGATGGGCGAAGCGCGGATGAAAATTTTGCACGGCTTCT
GCCGGGCCGGCGGTGATGGCATCTGTGGATGTCATTCCCCTCCTTGGAGGCATCGTCGAGCGTGTTCGCCTCATCCCTCGCGCTCTCGGTGTTGGTGGAT
GTCTCCGGGTGAAAGCCTAGATTCGATGTTCTGATCGGCACGATGGCGGTGTCCTCGACGCCGCTCCTCTGTTGGGAGCATTGTGTTTGGAGACACGACT
GGTTCCTCGTTGCTCTCCTCCGGTGTTCGCCGCTATCCTTTTCTGATCTTCAGTGGCGCTATGTACGTTGGTCGTTGGTGAATCCAAGGCGGCGTCTTCC
CGGATTGGATCGAGTCCTGCCATTCATCTGCCACTTTCTCTTAGGCGCTCAGGGTGGATGGTGCGTCGACAAGAGAAGTTCTGTGGAAGTGTGGTCTTCG
GAGGTGTCCGGCGTCGATCGAGACGCGGTGCTGTGTATCAGTTTAGGATAGGCTTTTTGCATAGTAGCTTGCCTAGCGGTGGTGTTTGTTTGTGGTCTTG
TCGGTGTGGTGTTCGTGCTACACTCGTTGTTCGCATCGAGCGGTAGCTTTCTTGTAACTAAATTCT
page-top