Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12869  (registered. 2007)
Contig Information
Length 727 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0506200 [Oryza sativa (japonica cultivar-group)] >gi|113532680|dbj|BAF05063.1| Os01g0506200 [Oryza sativa (japonica cultivar-group)]
Score 874
Evalue 3.70793e-92
Total Hit Count 412
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12869
AGATCGCATCGCCGCCCAGGGAAACGATGAGCCGCGAGGCCAGCGGCGCGTCGGTGAGCTCTGCCCCGGTGCCCGAGCCAGAGCGGCAGCAGGGGCAGGG
GAACCAAGGGGAGGAGGCGGGGTGGACGCCGCTGGAGAAGGTGGCGGATAAAGTGGAGGAGCTGTACAGTCTCCGTGACACCTTCTTCCCCCGAGACCCC
TCCGAGAAGTCTGCGTCCCTCCGCGCCTGCGCCGACGCCGCCCTGGGAGTCCTCGATTCCCTGCCTCCCGAGCAAAGAAAATCCCCAGAAGAGCGTGTTA
TTTATGAATTTTTGATGGGGAAAATACTCGATGTCTTCCCAGATTATTGTAAGGAGGCTGAAGAGCATTTATCCAAAGCAGTAAAGCTGAATCCATCTCT
TGTGGATGCATGGCTATGTTTGGGTAACTGCATCTGGAAGAAGGGGAATTTGGCATCAGCAAGGAACTGTTTCTTATTAGCACTAAGTAAGGGCACAGAT
AAGAAAATACTATGTCAACTCTCAATGCTTGAAAGGAGTATGGCTCAATCTAGTGAAGACCAAGCGTTGTTAGTGGAAGAGAGCATTAATCATGCAAAAG
AAGCTGTAATGCTGGACATAAAAGATGGAAATTCCTGGTATAATCTGGGTAATGCATACCTCACAAGCTTCTTTGCGAGCGGAGCCTGGGACAAAGCTAG
GCTTCATCATTCGATCAAAGCATATCA
page-top