Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10794  (registered. 2012)
Contig Information
Length 1386 bp
Clones alternative view 154 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 1
Wh_r Root 3
Wh_yd Spikelet at late flowering 11
Wh_SH - 2
Wh_DPA20 Seed DPA20 14
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 9
Wh_KMP Shoot grown under continuous light 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 8
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 8
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XR Roots, 18 day old plants were grown hydroponically 8
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 9
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_SP 18
WH_XA Root 7
WH_XB Root 10
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242035869|ref|XP_002465329.1|| hypothetical protein SORBIDRAFT_01g036580 [Sorghum bicolor]
Score 677
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10794
TTTTTTTTTTAGACAATAAAGACCATTCGCATAGATGAAAGGATTGCACCACAGTACAGAGGTTCTCATCACGGATCCATGGTTTGAAAAACAAGCACAA
GTGCCAAATGCTTATTACATCGGATAGCTCGCCATAGCAGGACACAACGACAGGACAGAAACTAAACACACACACTCACGGACACATCACCACCGCCGAC
CGCACACGACTTTTATTCTACCGACGCGGCAACAGATCACAGGCCGATCTCTACCAACTCCGGGTCACGGTGGCGATCAACTCAGCTTCAGCAGCATGAC
ACGTTTACCAGGGGAGGATCTTCCAGCGCTGGTTGTCGCCCTCGCACCACTTCCACAGCACGAGGGAGGTGCCGTCGCGAACGCCGCCGTGCTCCTTGTC
GCCGTGGAGAGCGTCAAAGTTGAGGTAGATGTTGTTCACCATGCGGATGCACCGGAAGCCGGCGCCCACGTCGCGGCTCTCAGTCCACAACACTGACTCG
TCCTGGTAGTTGGCGTTGTATGGCACCAGCTTCACAGGGTGGCCCTCGCCTTGGGAGTGCTTGATGGCCTCGCCTGTCACCTTGTTGACGAGGGCGAAGG
CCGGGTAGCCTTCCTCATCCTTGATGCGGTTGCTGTGCCTCATGTCCTTGAACCAGTGCTGGTACTCGTCGCGGGGGTTGGTGGGCGCGAGGACCACAGT
GCCGTTGCGGACGGTGGCGCTGAAGCCGTCGTCGGCCTTGCAGAAGATGCGCACGGTGGGCTCTGAGGAGCCGCCGCGGGGGGCGTTGGCGCTGCCTCCG
GCGTAGGCCTCTTCGCCCCAGGGGAGGATCTTCCAGCTCTGGTTGTCGCCCTTGGCCCACTCCCAGAGAACGACGGTGGTGCCGTCGTGCACGCCGCCGT
GGTCCTTGTCACCGTTGAGGGCGTCGAAGTTGAGGCGGATGTTGTTCACCATGCGAATGCAGCGGAAGCCCTTGCCGACGTCGCCGCTCTCCGTCCACAT
CACGGACTCGTCGAGGTACTCCGGGTTGAATGGCACGAGCTTCACCGGGTGGGACTGGCCGAGCGAGTGCTTGACGGCGAGGCCAGTGGCCTTGTTGACG
ATGGCGAAGGCGGGGTTACCCTCCTCGTCCTTGATCTGGGCGCTGAAGCGCATGTCCTTGAACCAGTGCTGGTGCTCGTCACGGGGGTTGGACGGGGCGA
GGACGACGTTGCCGTCACGGACGGAGAGGCAGTAGCCCTCGTCGGCCTTGCAGAAGATCTTGAAGGTGGGCTGGTTGCCTCCGGCGGCGGCCGGAGCGTG
GGCCGGGGGGTTCTGGCCATGGTGGCCGTGGTGACCGAAGCCGAACATGCTGTGATCTCTCGGGGGTTTGCGGGACAGAAGGAGAA
page-top