Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12569  (registered. 2007)
Contig Information
Length 1135 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit SC3 protein [Zea mays]
Score 844
Evalue 5.36973e-112
Total Hit Count 278
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12569
TCGGTAGAAAGTGGACAGTCCTACAATGTCACTTCATCACAGCAGTATCCTATGCCAACTTAAGATTATAGTCAGAGCCAAGGCAAACATATACTTTTGT
TTATGGTGCCATCTAATCCATGGAATTAATCTTGAGACCTATCATCATCTGAGATATGTGGCAGTCAAAATGCCGCTCTCATAGCGCCCCTTGTCGCATC
ACGCTTCATCTCTGCGGCCTTTCCACTTCCTCGGAAGTACATGTACACTTGCTGGATAACCCAGATGCTCAACAATGACTCCAGGGCAAATAATCCAAAC
CCAATGAAGTAGAAGATCCCAACTAGAGCATTCACACTGATAAGATCAATCGCCGGCAAAATTCCTGCCAAAGACTTGCCCTCAAAGACAGCGGGAGGAG
CCACGGCAGCAAATACGACGAAAACGATGTGAAACAAGTAGAGCAAGAAAAACAATCCAAACTTCAACGCGCTGTCAGTCCTCATAGCATTATAAAGAGG
GCGATACCATAACACATATGCACCAGGAACCCCAGAGATGAAGTAGATTATTGCTAGCAACCAGATTTTCACACCTTCCCCCTTGATCCAGGCTGAAGTA
ACTGCTACGACATTCCAGAAGAGACAGCAAACCAAACCAAGAAATGACGCAAATGCGAAGTATTGCATTCTTTGAAGATGAGTCGGTATCTCATTGGCAA
TGTCATGGTGGATGAGTGGCAGAAAAGGAGGCCAGTTTTTCTCCTCGATGACAATACCAGCTCGTGCTGCAGCTTCCTCCCTTCTTTTCAATTCCTTCTC
CCCTCTTGTTCAACTCTGCTTCCCTCGCTTGCAGCTCCTTTTCTCTTTTCTTCAGGTCCTTTGAATGACTCAAGAAGGGGATATCCACTGTGGCACTGAA
ATCTGCAGGTTCCGGGGGAAGGGGCGAAAGCCGCGAATTCGAGGAAGGAGCAACGTTTCTGGGATTTGGCATGTAAAACGCGCCGCCGCCACCATAGTTG
GACTGCCCACCAGCTTTGCCTCGCGCTTGTTCCGAGAAAGGATTCACGTCCTCCTCCTCCTCGAAAGGGTTGCCGCCATCGTAGCGCCCCGCCATGTCCC
TCCCACACGCCTCGGCGCGCTTGCTTGCACCACCC
page-top