Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12532  (registered. 2007)
Contig Information
Length 857 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein NEMVEDRAFT_v1g48356 [Nematostella vectensis] >gi|156380014|ref|XP_001631750.1| predicted protein [Nematostella vectensis] >gi|156199625|gb|EDO26533.1| predicted protein [Nematostella vectensis] >gi|156218795|gb|EDO39687.1| predicted protein [Nematostella vectensis]
Score 81
Evalue 4.56136
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12532
TTTTTTTTTTATAAGAACATTTTTTCTGGAGAATTTAATGTTCAAGTAAAATGTACATACAATAACAGATACATTTTCATTTCACTCCTACTACAGCTCA
CTACAACATAGACTAGTACATCTCACTTCAAATAAACAGTATTGTTCTCAGAAGCAAAATACGCCACCACACGCCATGGTGCGCCATCTTACTCGATCTG
GCCTCAAGGAACTAGCAGCGTTGGTTGCTCCTTTGGACCGGAGCTCCTTGCTGTAGAGGATGGCTGAAACTCGGATGCGGAGCTCCCTGATCTTCTTGAG
CCTCTCCTTAAGCAAAAGCATTATCCTTACAATTCTGGAAATGGACCAACACAGTAGTAGTGAAGCTATGCGGGGATCTTTGTAAAGCAGTTTATCGGTT
CCTGGAGACAACAACAGTCTTTCCTCTCCTGCCCCAGTAGTGACGCAGACGATGATGGTTCCTGGGAAAGAGAGCAAGGTTTGAAGCACTAAGGAAAAAT
GCTACTGCAACAGTGAAGTTTTAAGGAATCAGCCATCAGGCATCAGCATACATCTATTGGAAACAGAGCATTGATATACAGACTAGCTGGGTCACATGCA
AGGTACACTAGAAAGGTATAAATGAATAAATTGACAATCATCAATACCAGATTGCAAGACATAACAATTATGTACCTAAGCAAGTCGACAATGGCATAGG
GCAGGATATAAAATCTGGATACAAGTAGTAGACAAACTAGTTCCAATAGATTGAATGAATGGAACTGCTATATAACCAAGTTAGAGCTAGCAGAAGTTGC
AGGTAAATAAACATCCATAGAGCTAGCAGTAGCAAAAGCGAGGCGAGGCTAGCAGTA
page-top