Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10761  (registered. 2012)
Contig Information
Length 919 bp
Clones alternative view 60 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 1
WH_XA Root 6
WH_XB Root 3
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242038183|ref|XP_002466486.1|| hypothetical protein SORBIDRAFT_01g008610 [Sorghum bicolor]
Score 179
Evalue 3.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10761
TTTTTTTTTTATGTCACCAGTGCTCAACATAATTAGTTAATTGATATACCAGGTCTAACACAAAGAGATGGCAGGACTCACTCGCAACAATCTGGATGCA
ACTCCGCACAAACAAACATATATTGTATTACTAACGACAATTAATCCAAGGTAGCAGGACTAGCAAAACTTCCAGCAAATAAACAGTAAACAGAGAGAGG
GGGGGAGGGGGTGAAGAACATGAGCCATGATTGGCCGGTTTATTGCTTTGTGCTCAGCCTAACAGCTGCTGAGCCTCCTGTGCCTCCTCCTCCTCATAGG
CGAGGAGGAGGAGGAGCCTTCTTCAATCACTGCATCACGGTGATGAGCTCAAACTCGACCAAGGACACGTTGTTGTCCTCCTTCACCTTGAAGTCGGCCG
GGCTCTCGGCGGCCTTGAGCGTCCCCCACTTGTCCACCGCCAGGCGCATCGACCCCTTGTACATGTCCACCCTCGCCTTCCTCGCCTCCACGACTGCCCC
GGGCTTCATGATGTCCACTTGCTCGTTGCGTGCGGTGAAGACGACTACGCCGGTGTCGTCGCCGACGATGCACTCGGCGATGCGCATGTTGCCGCCGGCC
CTGCCGCCCTGCGGCCTGTGGAGGACGACGGGCTTGGCGCTGAGCACCCGGAGCTGGAGGTTGTGGCCGTAGGTGCCCGGCCGGAGCTCCTCCACCTTGT
CGAACGTCATCGCCGCCCTTTGCCTGGTTTGGTTGCCGACGGTGGAGCGCGTCTCCTCTCTTGCTTGCGCTGCTTGGATGTGATCTGAAGATGAGATCCA
CCCAAGAGGATGAGGAGGAGGAAGAAGGAGGAGGAGGAGAGGTTTGTCTCTTGGTTTTGTCCGAGACAGAGGAGGAAACCAGGACGCAGGTTGGTTTGTG
ATATGAATCCAAACCCAAT
page-top