Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12435  (registered. 2007)
Contig Information
Length 537 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pseudouridylate synthase/ transporter [Zea mays]
Score 368
Evalue 8.46956e-34
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12435
TTTTTTTTTTAGAATCGCACCATATTTGATCAAAAATAATGTATTGGACATCTGTATAGTTTTGCAAAACATAGGGCTATCCATTCACTATAGTTTTGCA
AATAACAGAACTGCGACAGTCATACATTGTTCAGGCTTAACAAATGAATTCCTTGACTCCAAGGAGACCTAAGAAGTCAGATTGCAGATTCATGTAGACC
ATACTGCTGCATCAGCGGCTTGCACCACGACCATGAGTGCTCAGTGCCTCAGTCCACCACATGTCTAGAAATAGCTGCTCTCGATCGCAATCTTCCAAAG
GGCATGGCCAATTCTCATAGGTATCCCTTGGTGATTTGTTCTTGCAGTTCGTCGAAGTTCCAAGCATCATTGACCGAATAGTCACCAATTGAGTCCCTCC
GAAGGGCAGTTAAATGAGCACAGCTTCGAAGCGCTTTCCCCAAGTCTGCACAGAGGGACCGAATATATGTTCCTTTCGAGCAAGTAACTCGAAATATCAA
ATTTTGCCTGTCTTCTAAACTGCGCTCAATATCAAAC
page-top