Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12428  (registered. 2007)
Contig Information
Length 1441 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_024418 [Oryza sativa (japonica cultivar-group)]
Score 366
Evalue 8.90949e-33
Total Hit Count 15
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12428
CGCGCCCGCGCGCCACCACCCGCTCCTCCTCGCCTTCCAGATCGCGCCGCCACCTCCCTCCCCATCCCCTCCATGATCTCTCCCTCGGTGAGCCACCGGC
GAGCCCCTCTGCTGCCCGCGCATGCACAGCCTCGCCTCCTCCTGCTCTCCATCGACCCCCTCCGCGTGCTCGCCATCATCGCCTCCCTCCGCCGCATCGA
CCCCAAGGTGCTGGCGCAGGCGACCAGGAAGCTGTTCCAGGGTGAGCCGATGAAGAGGCGGAAGGGAATTTGGATGTAGATCAACAACTACGAGGAGGGG
GAGGAGAGCGAGAGGGGCAGCGTGGTGGCCAGCAAGGGGAGCACCATCACGGGAGCCGCGTCCTCCCGGTCCACGGCCACGTCGGGGAGATGCCGCCGAC
CTTCGCTGGCGAGCGGCGGCTGTGAGAGTCTGGTGCGGAGGGCGGACTCGATCATGAAGTCGCTCTCGTGGTCCAAGGCGGCCCCAGTCACGGAGACGGC
CATCCGCGCCGCCATTGGCGACAACGCTGTAACTAGCAAGGCTGTGCGCTGGTTGCTGAAGCAGAAGAGAGGGTTGCGTCGTGCGGGCACTGGTGGCCGC
CCGGATCCGTATGTGTACATGGTACGTGAAATCTGTGCCACACAGTTTGCGTTTGGATGATGATTTGATTTCTGAAAGTAGCTAAATGTAAGGTATGACT
GAATCAGTATAACTGAGAGTCAGTGTCCAACTTCTAGATGGAGTTAGGGAGTTGTTACTTATTGGAGTAGTAATTTCCAGTTATTCAGTACAGAGTAAGT
AGAATCTAAAAGCAATTGTTAAATCTTATTAATTTATCCTAGTTCCACTCACAACCTCAGTTCTATAATTCTGGAAGCCAGTTGAATCTTGAACACTGCA
CATTTCGAAAAAATGCTTCCAAACCACATAATTTCATTCCTTGATACAGAAAGTACAGCAAGTTCTGATATACATCAATCCTGCTTTCCTCGTACCAATA
AAGCATGTCCATAACATTGGATTATAGCAAAAAAATTGCTAAAAGAACAAACGCCCAGTCAAAGCTTTGAATGATTAGGTACTGTAAATTGGATCTCCTG
CATAACTGCACTTTGCCATTTGCTTCAGGCACTTCTTGTTCTGCCAATCCACGAGCAGGGAGCGGAAGGCGCAGCCAGCGACCAGCGAGCACATGGGTGG
CACAAGTGGCGACGGAGAGCGGCTGGAGACTGCCAGTGATGAGCGGCGATGGCAACCTTGAGACCAGCAAGTAGGCGACGGCGACCTCATTGTGAAGTGG
CTGAATCGACTTGAGGCGGTTTCTTTGAAATTCTTGGAAATGCTTTGGTAGTTTCTTTCGGCGAGAAACTGTTTCATACTGAAGTTTACTGGCGCCGCCG
GATTCGAGGGTGGAGCCCNAGCCTCCACTGGAGCATGGATC
page-top