Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12396  (registered. 2007)
Contig Information
Length 787 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0589800 [Oryza sativa (japonica cultivar-group)] >gi|50725436|dbj|BAD32908.1| putative receptor-like protein kinase 2 [Oryza sativa Japonica Group] >gi|113596004|dbj|BAF19878.1| Os06g0589800 [Oryza sativa (japonica cultivar-group)] >gi|218198467|gb|EEC80894.1| hypothetical protein OsI_23539 [Oryza sativa Indica Group]
Score 811
Evalue 8.80862e-85
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12396
TTTTTTTTTTGAGCAAACTAAAAACTGAGAAATTTCCCATTCAAGTTCCCCAGAATGAGCTACAACGTCCTCTGAAACTGTACAAGAAACCCCTAACCAA
AGCTAGCTAGGCAATTATCAAAATCCTACTCCTTTTCCTTTCTCATATCATCTCCTGATCTCCTTCCATTTCTCTTCTTGCAGAAGATGCGCCACTGAAT
CCACCGCGGCAGTGCTCTCGTCAGGCTTCCTGGCTGCTCGGCTTGATGAGCGGCTGCTGCGACGTCTTGGCCCACTCCTCCGGCGGGCTCTTCACCTCCT
TGAGGAAGGCCACCACCTCCTTCATGGTCGGCCGCTCCGCCGGCGCCGGGTTCACGCAGAAGATGGCGATGCCCAGTGTCTGCAGCATCTCCTGGACCAG
CTGGTCCGGCATGCCACGCAGCTTGGGGTCCAGGATGTTCACCGCCGGCTCGTAGCTCCCCATCTTCTTCTTGGCCCACTCCACGATGTGGAGGCTGTCG
CTGACCATCGGCTCGATGGCGCTCCGCCCGCTCAGGATCTCCAGGAGCACCACGCCGTAGCTGTACACGTCGCTCTTCTCCGTGATGTTCGCCGTGTAGC
CGTACTCTGGAGCAATGTATCCGTAANAACCGGCGATGCGCGACATGGCATGATGATANTTGGGGGAGTTCATTANCTTGGCCANCCCAAAGTCANCCAA
GTANGCCTCATACTTCNAATCAANCANNATGTTGTTGCACTTGACNTCCCGGNGGANTATCNNCNGGACNCANNCATGGNGNANATA
page-top