Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10752  (registered. 2012)
Contig Information
Length 869 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|109729535|gb|ABG46232.1|| germin-like protein 1a [Hordeum vulgare subsp. vulgare]
Score 347
Evalue 7.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10752
GAAGCACTCTTGATCAACAAACTCTAGCTGATCAGTGCTAGCTAAGCTTGCTACATAGCAAGCCATGGGTTACTCCAAAAACCTAGGGGCTAGCCTGTTT
GCCATGCTGCTGCTTGCTCCGGCCGTCCTGGCCTCCGACCCTGACCCTCTCCAAGACTTCTGCGTTGCTGACCTCGACGGCAAGGCGGTCTCTGTGAACG
GGCATCCATGCAAGCCCATGTCGGAGGCCGGTGACGACTTCCTCTTCTCGACCAAGCTGGCCAAGGCCGGCAACACGTCCACCCCGAATGGCTCGGCCGT
GACGGAGCTCGACGTGGCCGAGTGGCCCGGTACGAACACGCTGGGTGTGTCCATGAACCGTGTGGACTTCGCGCCGGGAGGCACCAACCCGCCGCATGTC
CACCCGCGCGGGACCGAGATCGGCATGGTGATGAAAGGTGAGCTCCTCGTTGGAATCCTCGGAAGCCTCGACTCCGGAAACAAGCTCTACTCTAGGGTGG
TGCGTGCTGGAGAGACGTTCCTCATCCCACGCGGGCTCATGCACTTCCAGTTCAACGTTGGTAAGACAGAGGCCTACATGGTTGTTTCCTTCAACAGCCG
GTGCTCACCAAGGCACTAAGGGTGGAGGCCGGGGTCGTCGAACTTCTCAAGTCCAAGTTCGCTGGTGGGTCTTAATCCCTGGGAGCTTGCCCTGAAATGA
TGAGTATATAATTTGATATATGCATGCCAATGAGATTTAATAATTGTTCAGCAGAAGACACGTATTCAAGCTTCTAGCTAAGCTCGCATGCAGTTGTAAT
AAGATTGAATAAGTTAGCCTCGCGGTTTAGCCTTCAGAGCCAATACGAGGAATCGAAGTGTACTGCTTT
page-top