Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12251  (registered. 2007)
Contig Information
Length 814 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit asparagine synthetase 2 [Hordeum vulgare]
Score 1129
Evalue 4.70938e-122
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12251
TTATAAAGCGAGGCTAAAGCCATTTTAGTAATTAAACAGCAGAAACATAGGCCGTTCTTATTATAAGGCTGAAAAGAATTTATGCATCTTATTATCCTTT
AGTAGGACACGATATGATACATATACCATTCATCAGGTCTCAATGGCAACACCAGGCACCACGGTCTTCATCACCCCATGCTTGTTGCTACCTCCCACAG
CGACTGTGTCCTGCTCGTAGGCTGAGAGATGGACTCCAAGCGCTGCTCTCCCAGAGGGGTCCAGGTTTCCAGACCACTGGGCATCCCACTCTATAGCCTT
GGCTGTGCTGCACGCCACGCTTGGCCCGCCTGGCACCGTCAGGATGGCCGAGCTCTGGGGGAAGTACCTCTCGAAGATCATCCTGTAATAGTAGGCCTCT
TTAGTTGTTGGGGTGTTGTGTGGGTAGATGAACTTTGCATTGGACATCATCTTATCACTCACATTTGATGCTGCATGATCCTTCAGGCCATCAATCCAGC
TATACCCAACACCATCACTAAACTGCTCCTTCTGCCTGTACAGAATATGCTTCGGCAGGAAGGGTTGCTCCTCATCATCGAACGCTTTCCTCAGTATCCA
TTTCTCAATTCTTCCAAGATCAGGCCGGATCATCTTCCATTCGGGATCTATGCTCATAGCCTCATCGATGAACTCCTTGTCCAAGAATGGCACACGAACC
TCAAGGCCCCATGCAGATGTTGCTTTGTTANCCCTCAAGCAATCGTACTGATGGAGAGCTTTAATCTTCCGACATGTTTCCTGGTGGAAACTCCTCCTTG
TTAGGGGCCTTGTG
page-top