Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10735  (registered. 2012)
Contig Information
Length 1444 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218199659|gb|EEC82086.1|| hypothetical protein OsI_26084 [Oryza sativa Indica Group]
Score 719
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10735
TTTTTTTTTTGGAATGCAAGTCCCAGTTATTATTGCAAGTACCTCATCAACTTCAAATGTGACAGACAGGGAGCTGCGAGCCTATCCCGCACTACCTGGT
GTACCTCTGACAGCATTAGACAACTAAAAACTGGGGCCGGTCTTGTGATCTATCATGTGATCGATCGCATTAAAACAATTGTGAGACTCAATGCTCGTCG
TGGAGGTGGCTATATTTCCAAAGATCGAAAGAATAGCCTAAGGTAAATTGCACATGATGAATGAGCATGTATTTTACAGCATGAGTAGAATTCTAGTCTT
TCTTGTACACTACTGTTGGATAAACTGGATTCCACATGTTGTTCTTGACATAATCAACTGTTTCTTCCTCGCTCAGTCTTGCAAGCTCGCGTGCATCCAT
GTCACGGTATCCCTCAGCTAGGTCCTCTGCAACAGCTTCCCTCACAACTGCTGCCGCCACCTCCTTAGTGATGTCACGTATTCTGGAGGTTGGAGGGTAA
ATTATCCCTTGGAGAACCTCCTCCTCTTTCATGTATGAAGCCAAGCGCTCTGCCGCCGCCTGAAGCATTCCATCAGAGACAATCCGTGCACCAGACAACA
GGGTTCCAAGTCCTATTCCAGGAAAGAGATACATGTTATTCCCTTGATTAGAGTGGCCGATCTTTCCATCACCAAGATCCACATCATCAAATGGGCTTCC
ACTGGAAAATACGACCTTTTCACCAATAATTGAGAAGGCTTCTTCAGGTGTACATTCAGCATTCTTAGTTGGATTTGACATCGCAAAAATTGCTGGTCTG
GAAGAGGACGAATCTTTTAGTGCTTCTAAAACCTCCTTTGAGAACAAACCACCAACAGCAGATAGTCCAAGTATGACATCAGGCTTCACCTTTTTAACCA
CTTCAATCAAGCTTGCACCCTCATTTAGGCCTTGATGAGTTAGCTCACTCTTTCTCCTAGCAAAAGGACGTGCATCTGGGTCTATGTCTACACGTTCCTC
TGTTATTAAACCGTGAGCATCGACTATCCAGAATTGGCTCCTAGCACTCTCAAAAGCAACCTCGTTGTTTCCCAGCATCCTTGCCATGGTCCTGCTTGCA
GCATTCACAACACCAATCCCAGCACTGCCAGCACCTGCGACAACAATCTTTTGCTTTGGGAAGTCTATCATTGGCCTTCCTTGTGCTCTTACAGCTCCAA
GAAGACCAGCTATTGCAACGCCAGCAGTTCCCTGCACATCATCATTAAACATACGATAAGTCTTCCTGTAACGCTGCAACAACCTGAAGGCCCACTTGCT
TTGGAAATCTTCAAACTGTACAATCACATTGGGCCAACGAGAAAAAACAGCTTCCATGAATTCATCAATAATTTCAACATATTCTTCTCCCTCAAGACGG
TGTTCTTGTAGCCCAAGATAAAGAGGATCCTTGAGGAGTTTCTC
page-top