Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10732  (registered. 2012)
Contig Information
Length 1536 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 4
Wh_f Spike at flowering date 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464123|ref|NP_001055661.1|| Os05g0438800 [Oryza sativa (japonica cultivar-group)]
Score 744
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10732
TCCGCCGTATTCCTTCCTTCGTCTCGCCGCAGTCCACCTCGCTTCATCCGCCGAGCAGAGCCCTCCAGACGCCATCCACGCTCCCGTGAACAGATTTCTT
ACAGGAAACTTGACAAATGGCTGATGAGGATGTTCAACCTATCGTGTGCGATAACGGCACTGGAATGGTCAAGGCTGGTTTTGCCGGTGATGATGCACCC
AGGGCTGTCTTTCCTAGCATTGTAGGAAGGCCACGCCATACCGGTGTCATGGTTGGTATGGGCCAAAAGGATGCCTATGTGGGCGATGAAGCTCAAGCAA
AGAGAGGTATCCTGACTTTGAAGTACCCCATTGAACATGGCATTGTCAACAACTGGGATGACATGGAGAAAATATGGCATCACACGTTCTACAACGAGCT
CCGTGTCGCACCAGAGGATCATCCTGTGTTGCTGACTGAGGCCCCTCTCAACCCCAAGGCCAACAGAGAGAAAATGACCCAGATCATGTTCGAAACCTTC
AGTTGCCCAGCAATGTATGTCGCAATCCAGGCCGTTCTGTCCTTGTATGCCAGCGGTCGAACAACTGGTATTGTGCTCGACTCTGGTGATGGTGTGAGCC
ACACTGTTCCAATCTATGAGGGATACACGCTTCCTCATGCTATCCTTCGTTTGGACCTTGCTGGCCGTGACCTCACGGATAATCTAATGAAGATCCTCAC
AGAAAGAGGGTACTCCCTCACAACAACCGCTGAGCGGGAAATTGTCAGAGACATAAAGGAGAAGCTTGCTTACGTGGCCCTTGATTATGAGCAGGAGCTG
GAAACGGCTAGGAGCAGCTCCTCTGTGGAGAAGAGCTATGAGATGCCTGATGGTCAGGTTATAACAATTGGTTCAGAAAGGTTCAGGTGCCCTGAGGTGC
TATTCCAGCCATCTCATGTTGGTATGGAAGTTCCTGGTATACACGAAGCGACATACAATTCCATCATGAAGTGTGATGTTGATATCAGAAAGGATCTGTA
TGGTAATGTTGTTCTCAGTGGAGGTTCTACCATGTTTCCTGGAATTGCTGATCGCATGAGCAAGGAGATCACGGCCCTTGCTCCTAGCAGTATGAAGGTT
AAAGTTATTGCACCACCTGAAAGGAAATACAGTGTCTGGATCGGTGGCTCTATTTTGGCCTCTCTTAGCACTTTCCAGCAGATGTGGATCTCCAAGGCAG
AGTACGACGAGTCTGGTCCCGGCATTGTCCACATGAAGTGCTTCTGAAGAGTCGGGGAAGGTTGTTTACAAAGGGGACTTTGCTGCCAAGAATATATAGT
AGTACATGGTACATGGTTAGTGTTCTGTAGAAGATGTGTACCCTCAGAGGAATAAGGGGTACAGGAAAATCAGTCTCGGTTCAGCTTTTCCTTTTGGCAC
AATTGCATGGCCTTGCATGGTGCTTGCCTGCTGTATGAAATAATGAAATGGAACATATGTGTATGCCTAAGCGACATTGTGTGGTACGCCATACTCGTGG
CCCTGGTTGAAATCGTAGTGACACTGAAAAAAAAAA
page-top