Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12131  (registered. 2007)
Contig Information
Length 479 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0268100 [Oryza sativa (japonica cultivar-group)] >gi|56783728|dbj|BAD81140.1| putative major facilitator superfamily antiporter [Oryza sativa Japonica Group] >gi|113532221|dbj|BAF04604.1| Os01g0268100 [Oryza sativa (japonica cultivar-group)] >gi|218187948|gb|EEC70375.1| hypothetical protein OsI_01319 [Oryza sativa Indica Group]
Score 273
Evalue 6.56686e-23
Total Hit Count 86
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12131
CCTCGTGCCGAATTCGGCACGAGGCTTTCTGTAACACTAATGTCCATCTTCAAAGCTGTCGCTCCGGCTGTTGCAGGTGTTATATTTTCATGGGCTCAAA
GGCGCCAAACTGCTTCATTTCTTCCAGGCGACCACCTTGTGTTTTTCATGCTTAACGCGGCCACCGTCATCGGTCTTATGTGCACCTTCGGACCACACTT
TGCTAGGGGCAGCACGAAGCATTGATGTAGTAATATTGTTGCGACCTGGGAAAGAACAAGGAACTATTGTTCTGTCTTGTGACCTTCTTCCCCTTGAGCA
TAGTTTTGTGCTCCACGCCACATGTTATTATTATTATTTGTAGTACAGCGGCATATAGTGTTGTTAGAAACATATATATGCCCAAGAGGCAATCATAGAT
GTAAACAATATTCCTTTGTATTTATGGTTTATTCGCTCTTCTTGAATAAACTCATGTGTATTTATCAGCAAAAAAAAAA
page-top