Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10727  (registered. 2012)
Contig Information
Length 742 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|62733403|gb|AAX95520.1|| Putative Glycosyl hydrolase family 1 protein [Oryza sativa Japonica
Score 353
Evalue 8.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10727
CCAATATACTGCTGGCGTCCACTGCTTATCAAGTACAGCTACTTGCCGCAGCAAGAGAAAATAAACTCACCATTAGAAGGAGAGCATGAAGATGGAGGGA
AGAACCAGATACAAGCAAACCAGCAGGGAGAGCAGGACCCGGGGGCTACTCGAGGTGGCCGAACCACCAGCTGCTGCCATGTTGCTGCTTGAGACGCCGG
AGCCGGCTTGAGTGCTGCCAGAAGTAACTGCGCCGTCTTTCGAGCCGGGCCCCGACGCCTGCAGCATGTTCTTGAACCAGTAGGCCGAGTCCTTGGGGTA
CCGCTTGAGGGTGGTGAAGTCGACGTACACGATGCCGAACTTGGAGGTGTAGCCCGACAGCCACTCGAAGTTGTCCAGGAGGGACCACGCAAAGTAGCCC
ACCACGTTCGCGCCGTCGTCGATCGCCTTCTTCAGCTCCGCGAGGTAGGTCTCGTAGAACTCCACCCTTGATGCGTCGTGGAGGAACTCCTCGCGGGTCA
GGTTCGCGGGTTGGTCCATTCCGTTCTCGGATATAATGATCGTCGGGTTGTTGTACTTCTCCCTTATGTAGTTCACACATCCGTACATGCCCGTCGGGAC
GATGTAAAGCCAATTGGAGTTCGCCTTCTGTCCAATTGGTACGCCATTTCGCTGAAATATATATTGAACATGCCAGTCAGATGAGTAGCTTGTCGGTGGT
TGCTGAGGCGTTGGTTGGTCCGCCATGTAGGTCGCTGTATAC
page-top