Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12105  (registered. 2007)
Contig Information
Length 237 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] (no hit)
Score 839
Evalue 7.7586e-88
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12105
TCGTAGTTAGAAAAACTTCGTAAACAAATGTACTCTGGTTAACAGACCAAAATACAGTTGATCTATCCGAAACAGATCCCCTAGGACCCGAAAAATCGTC
GTTCCCCCGTCAAACCTCCATATCGTGAGTTTCTACCCTCTACCCTCAGCTTCCGTCCCCGCCGCCAAATCCTTAGCCGCCGTCGCAGCTGCTCAAACCC
TAGACGTCCTTCACCGCCTGTCCATCCATTGGACGCC
page-top