Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12083  (registered. 2007)
Contig Information
Length 850 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit AGAP008482-PA [Anopheles gambiae str. PEST] >gi|157014777|gb|EAA12280.5| AGAP008482-PA [Anopheles gambiae str. PEST]
Score 107
Evalue 0.00434981
Total Hit Count 318
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12083
ACAGATTAGTGCATGCATGCATAATCATACACTACACCAATAATCCAAACATAATTAATTAGTACTTAGAGGAGGAAGCAACTACTACTTAACAATGGTC
TATTACAGTTACCATACATATTATTAATTAAATTATGATTCATTCATTCATTCTTCTTCTTCTTCCTTGCGCTCCAGTCCAGTCCAGAAAATCACCATTG
TACAGTAAAGTCCAGAAAATCACCATTATCTTCTTCTTCTCATGATACATTCCTTGTGCTCAGCTCATCTCATCTCAACTAACCACACATCTTTCTGCAG
ATCCCAGCTTGTCTTCTCCACCCTCCCCCTCCACAGGAGCAGTCCCTGCTGCAGAGCTCCCCAGTTTCTTATCAGATTCAACCTTCTCCACATTCTCTGT
ACCACTCGCTTCTGCTGCTGCACAACCATTCTTATTAGAAGAGTCAGTTGCGTCTCCTACAGCCTCGACATGCCGAGGAGGAGCACTCGCTACCTTCTCT
GCAGCAGAAGAGCCCAGCTTCTCAGAAGAAGAGTCAGTTGCACCTCCTACAGCCTCGACATGCCGATGAGGAGCACTCGCTACCTTCTATGCAGCAGAAG
AGCCCAGCTTCTCAGAAGAAGATTCAGTCGCACCTCCTACAGCCTCGACACGCGGAGGAGCACTCGCCGCCTTCTCTGCAGCAGAAGAGCCCAGCTTATC
AGAAGAAGATTCAGTCACACCTCCGGGTTCCACAACAACAGCAGCACCACCCGCTTTTGGCTGCTCTGCAGAAACCGGCGCATCTGCAGCAACCCCAGTT
TCCTCACCACCCCCTGAAGCAGCCGNCACCACCACACCTTCTTGGCTCTG
page-top