Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12063  (registered. 2007)
Contig Information
Length 502 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0549900 [Oryza sativa (japonica cultivar-group)] >gi|113611472|dbj|BAF21850.1| Os07g0549900 [Oryza sativa (japonica cultivar-group)]
Score 415
Evalue 2.43854e-39
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12063
CCGCACACGAGTCCTTCTTCTCTCAAACAAAAACAAATCCAGCGACGATGTCTGGGCGCGGCAAGGGCGGCAAGGGGCTGGGAAAGGGCGGCGCCAAGCG
CCACCGGAAGGTCCTCCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGGAGGCTGGCCAGGAGGGGCGGCGTGAAGCGCATCTCCGGCCTCATC
TACGAGGAGACCCGCGGCGTCCTCAAGATCTTCCTCGAGAACGTCATACGCGACGCCGTCACCTACACGGAGCACGCCCGCCGCAAGACCGTCACCGCCA
TGGACGTCGTCTATGCCCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGAGGCTAGATTCGTCTAGTGGTGCCAGTAGTGGGGCAACTTCCTCGTTT
GCTCTGTGTCATGTGTTGTGTGGTAGATGGGATTTACTGCTTTGGCGTGCGTCGTTGTGCTCTGTCTTGGGTTCAGTAGGCTGTGTAATACCCAAAGTAT
GT
page-top